ID: 993692392

View in Genome Browser
Species Human (GRCh38)
Location 5:91018317-91018339
Sequence ACAGTTCCTTCTGCTGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993692389_993692392 9 Left 993692389 5:91018285-91018307 CCAGACAGCTCAGCTCCAGATGA 0: 1
1: 0
2: 2
3: 21
4: 191
Right 993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG 0: 1
1: 0
2: 1
3: 25
4: 244
993692390_993692392 -6 Left 993692390 5:91018300-91018322 CCAGATGAATTTCTCAAACAGTT 0: 1
1: 0
2: 1
3: 22
4: 275
Right 993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG 0: 1
1: 0
2: 1
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993692392 Original CRISPR ACAGTTCCTTCTGCTGTCCC GGG Intronic
900538659 1:3191783-3191805 ACTGTCCCTCCTGCTGTCCCAGG - Intronic
900779576 1:4609029-4609051 GCTGCTCCCTCTGCTGTCCCTGG + Intergenic
900795127 1:4703245-4703267 CCACTTTCTTCTGCAGTCCCTGG - Intronic
900960063 1:5913307-5913329 ACAGTTGGTTCTGGTGTCCTGGG - Intronic
901284507 1:8066487-8066509 ACTGTTCCTTCTGCATTCGCAGG + Intergenic
901396817 1:8987821-8987843 ACGATTCTTTCTGCTGTCCCTGG - Intergenic
903178073 1:21592165-21592187 ACCCTTCCTTCTGATGTCTCTGG + Intergenic
905494170 1:38371532-38371554 AAAGTTCCTCCTGAAGTCCCTGG + Intergenic
905506021 1:38480384-38480406 CCAGTTCCTTCTGGAGGCCCAGG - Intergenic
906118420 1:43370671-43370693 ACTGTTCCTTGTGCTGAGCCAGG - Intergenic
906568054 1:46814378-46814400 AGAGCTCCTTCTGCTGTCCTGGG - Intronic
906635530 1:47407732-47407754 ACATTTACTTCTCCTCTCCCTGG - Intergenic
906693472 1:47808767-47808789 TGGGTTCTTTCTGCTGTCCCTGG + Intronic
910164673 1:84313551-84313573 TCAGTTCCTTCTCCCATCCCAGG - Intronic
912010714 1:104958011-104958033 ACAGGTTCTTCTGCTGGCACTGG - Intergenic
912363323 1:109112884-109112906 AACGTTCCCTCTGCAGTCCCCGG - Intronic
913971185 1:143419703-143419725 ACATACCCTTCTGCTGCCCCCGG - Intergenic
915737105 1:158091888-158091910 ACAGCTCTTTCTGCAGCCCCTGG - Intronic
915892098 1:159782052-159782074 ACAGCTCCTTCTTCTGTGCCAGG - Intronic
916290689 1:163163103-163163125 ACTTTTCATTTTGCTGTCCCAGG + Intronic
916959409 1:169873933-169873955 ACTGTGCCTTGTGCTGTGCCAGG - Intronic
917520489 1:175744048-175744070 AGGGTTCCTTCTGCTGAGCCCGG - Intergenic
918443226 1:184589776-184589798 TAAGTGGCTTCTGCTGTCCCAGG + Intronic
919162500 1:193849199-193849221 ACAGTTTATTCTCCTATCCCTGG - Intergenic
920286320 1:204882323-204882345 ACAGTTCCCCCTGCTCTGCCGGG + Intronic
920766663 1:208840141-208840163 ACAAATGCATCTGCTGTCCCAGG - Intergenic
921445531 1:215242521-215242543 ACAGTTCCTTCTGAGGAGCCTGG - Intergenic
921654704 1:217721141-217721163 ACATTTCCTCCTGCTGGCACTGG + Intronic
923095094 1:230769062-230769084 CCAGCCCCTTCTGCTGCCCCAGG - Intronic
923803700 1:237235526-237235548 ACAGTTCCTTCTGTCGTCACTGG + Intronic
924687548 1:246310575-246310597 ACAGTTTCTTCAGCTCTGCCTGG - Intronic
1062976977 10:1691067-1691089 ACAGTCCCTTCTGAGGTCCTGGG - Intronic
1063568013 10:7189407-7189429 AGAGTTCCAGCTGCTGACCCTGG + Intronic
1064033907 10:11900301-11900323 ACACTTACTCCTGCTGTCCCTGG - Intergenic
1064902343 10:20309079-20309101 ACATTTCCTTCTGCCTTCACTGG - Intergenic
1065184385 10:23157789-23157811 ACACTTGCTTCTGTTGTCCAGGG + Intergenic
1067757227 10:49014425-49014447 TCTGTTCCTTCTGTTGTCACTGG - Exonic
1068911946 10:62387981-62388003 TCAGACCCATCTGCTGTCCCTGG + Intronic
1069027448 10:63558309-63558331 ACATTTGTTTCTGCTGACCCTGG - Intronic
1069858245 10:71453581-71453603 ACAGTTCCTTCTGGAGCACCAGG - Intronic
1074960250 10:118438339-118438361 ACAGGTTCTTGCGCTGTCCCTGG + Intergenic
1075418033 10:122279967-122279989 ACACTTCCTTCTGCCGTGTCTGG + Intronic
1075860002 10:125667150-125667172 ACAGTGCCCCCCGCTGTCCCTGG - Intronic
1075860123 10:125667902-125667924 ACAGCTCCTTCTTCTGCTCCAGG + Intronic
1076395354 10:130134874-130134896 ACTGGTCCCCCTGCTGTCCCTGG - Intergenic
1076858194 10:133127712-133127734 TCAGTTCCTTCTGCGGCCCCAGG + Intronic
1077196087 11:1280872-1280894 ACTGTCCCTTCAGCTGTCCCTGG - Intronic
1077467793 11:2741845-2741867 CCAGTTCCTTCTCCTGGCCAAGG + Intronic
1078486640 11:11729285-11729307 ACAGTCCTTTCTCCTGTCCCAGG - Intergenic
1079394117 11:20046844-20046866 ACAGTTCATCCTACTTTCCCAGG + Intronic
1081908906 11:46687564-46687586 TCACTTCCTGCTGCTGTCCTCGG - Intronic
1083764690 11:64836218-64836240 GCAGCTCCTCCTGCTGCCCCTGG + Exonic
1084108759 11:66999073-66999095 ACATGTCCTCCTTCTGTCCCAGG - Intergenic
1085028989 11:73258341-73258363 ACTGGTCCTCCTGCTGTCCCTGG - Intergenic
1087688180 11:101288819-101288841 ACACTTCCTTCTGCTTTCTTTGG + Intergenic
1089759511 11:120712725-120712747 TCACTCCCTTCTGCTGGCCCCGG + Intronic
1089957114 11:122581681-122581703 ATATTTCCTTTTTCTGTCCCTGG - Intergenic
1090507253 11:127330473-127330495 ACAAGTCCTTCTGCTTTCACTGG + Intergenic
1091297700 11:134485533-134485555 CCACATCCTTCTGCTGCCCCTGG - Intergenic
1091883991 12:4002922-4002944 ACAGGTCCTTGTGCTGTGGCTGG - Intergenic
1091909354 12:4216310-4216332 ACAGTTCCTTTTGCAGTGTCTGG - Intergenic
1093017146 12:14165979-14166001 AGAGTTCCTTTTGCTGTCTTTGG - Intergenic
1095661373 12:44741081-44741103 AGAGTTCGTCCAGCTGTCCCAGG - Intronic
1095787545 12:46126491-46126513 ACAGTTCCTTTTTGTGTTCCTGG - Intergenic
1095983060 12:47983608-47983630 ATAGTGCCTGCTGCTGTCCCAGG + Intronic
1097925638 12:65122690-65122712 TCAGTTCTTTCTGCTGGGCCAGG - Intergenic
1099743305 12:86669268-86669290 GCTGTTCATTCTGCTGTTCCAGG - Intronic
1100782746 12:98046903-98046925 ACAGTTCATGCTGCTGGCACAGG - Intergenic
1101497153 12:105265589-105265611 ACAGTAACTTCTGTGGTCCCAGG + Intronic
1103471387 12:121184583-121184605 GCAGTTCCTCCTGCTCTACCAGG + Exonic
1104639209 12:130456634-130456656 GCAGTTCAACCTGCTGTCCCGGG - Exonic
1104791007 12:131482217-131482239 ACAGCTCACTCTGCTGGCCCCGG + Intergenic
1104879958 12:132063918-132063940 ACAGTTGCCTCTGCTGGGCCTGG - Intronic
1106356708 13:28990194-28990216 ACAGCTCCTTCCGAAGTCCCAGG - Intronic
1107152641 13:37129674-37129696 CCAGTTCCTTCTGTGGTTCCAGG - Intergenic
1107285384 13:38784553-38784575 ACAGTTCCAGTTGCTGTTCCTGG - Exonic
1107350947 13:39514217-39514239 ACAATTCCTTCTTATTTCCCTGG + Intronic
1111589242 13:90322597-90322619 ACAGCTCCAGCTGCTGTCCCTGG - Intergenic
1112470783 13:99686830-99686852 ACAGTTCCTAATTCTGACCCCGG - Intronic
1114374837 14:22133042-22133064 TCAGCTCCTCCTGCAGTCCCAGG - Intergenic
1117594499 14:57312339-57312361 ACAGTTCCTGCTGCTTTCTGTGG + Intergenic
1118878988 14:69810303-69810325 CCAGCTCCTCCTGCTGTCCCTGG + Intergenic
1119115221 14:72014058-72014080 GCAGATCCTTGTGCTGTCCAAGG - Intronic
1119196095 14:72717755-72717777 CCTGCTCCTTCTGCTGGCCCTGG - Intronic
1119460204 14:74795888-74795910 CCAGTTCCTTCTGATTTACCTGG + Intronic
1120819112 14:88895522-88895544 ACAATCCCTTCTGCTGTGCCTGG - Intergenic
1121257427 14:92540897-92540919 ACAGCTGCTGCTGCTCTCCCAGG + Intronic
1121332124 14:93056216-93056238 ACAGTTCCCTCTGCTTGGCCAGG - Intronic
1121448553 14:93993658-93993680 GCCCTTCCTTCTGCTGTGCCTGG + Intergenic
1122793676 14:104195135-104195157 GCAGCCCCTGCTGCTGTCCCTGG - Intergenic
1123176410 14:106422996-106423018 AGAGTTCCTTGTGCTGTCAGAGG - Intergenic
1124898396 15:33798947-33798969 ACAATTCATTCTGATGTCCTAGG + Intronic
1125394192 15:39229050-39229072 CCAGTCCCTTCTGCCATCCCAGG + Intergenic
1125728384 15:41879741-41879763 TCAGTTCCTCCTGCTGTCGTTGG + Exonic
1127122560 15:55784478-55784500 ACAGTACTCTCTGCTGTCACAGG + Intergenic
1130295784 15:82646690-82646712 ACAGAGCCTTCTGGTCTCCCTGG + Intronic
1131065951 15:89435350-89435372 CCCGTTCCTGCTGCTGTCCTGGG + Intergenic
1131066329 15:89436908-89436930 CCAGGTCCTTCTGGTGTCCTCGG + Intergenic
1131290541 15:91102994-91103016 TCAGGTCCTACTGCTGTCCCGGG - Intronic
1134786814 16:16952225-16952247 ACAGGTCCTTGTGCAGTCCCAGG + Intergenic
1136183737 16:28572845-28572867 ACAGCCCCCTCTTCTGTCCCTGG + Intronic
1136409387 16:30067281-30067303 ACAGCTCCTTCTTCTGCTCCGGG - Exonic
1137895422 16:52206558-52206580 TCAGATCCTTCTGTTGCCCCTGG - Intergenic
1138117999 16:54375473-54375495 TCAGTTCGTTCTGATGTCACAGG - Intergenic
1139380251 16:66526078-66526100 ACAGTTCCTGCTGATGGCCATGG - Intronic
1139960423 16:70714384-70714406 CCAGTTCCTTCTGCTTCTCCTGG - Intronic
1140796978 16:78447775-78447797 ATAGTTTCTTCTGCTTTCCTTGG - Intronic
1140918978 16:79519608-79519630 ACAGTCCCTTCTGGTCTCCAAGG - Intergenic
1142567440 17:849804-849826 CCATTTCTCTCTGCTGTCCCTGG - Intronic
1143334140 17:6159734-6159756 ACAGTTCCAACCCCTGTCCCAGG + Intergenic
1143372782 17:6450586-6450608 ATTGTTCCTTCTGCTTTCCTAGG + Exonic
1145000488 17:19301384-19301406 ACAGTGCCTTCTTCTGACCAGGG - Intronic
1146328399 17:31906446-31906468 ACAGTTTCTTCTTCTGTCTTGGG - Intergenic
1148567943 17:48644857-48644879 ACAGATCCTCCTGTTGTCACGGG + Intergenic
1148830017 17:50425472-50425494 ACAGTTCCCTGTGCTGCCCCAGG - Intergenic
1148834374 17:50458106-50458128 AAGGTTCCTTCTGATGTCCCTGG + Intronic
1149639516 17:58193730-58193752 ACAGCTGCGGCTGCTGTCCCAGG + Exonic
1150716692 17:67578336-67578358 ACAGGTCCCACTGCTGGCCCTGG - Intronic
1151220597 17:72609582-72609604 ACAGTCCCTTCTTATTTCCCTGG - Intergenic
1152516253 17:80826530-80826552 ACAGTTCACTCCGCTGTACCTGG - Intronic
1152543597 17:80989609-80989631 CCAGTTCCTTCTGCCGCCGCTGG - Intergenic
1157152247 18:45229808-45229830 AAAGTTGCTTCTGCGTTCCCAGG + Intronic
1157456470 18:47834221-47834243 TCAGCTCCTTCTGGTGTGCCTGG + Exonic
1157698624 18:49745142-49745164 ACAGTCCCTTCCTCTGTCCTGGG - Intergenic
1157908400 18:51591222-51591244 ACAGTTCCTTCTGCTGTAATTGG - Intergenic
1159977372 18:74730561-74730583 ACTTTTCCTTTTGCTGTCACTGG + Intronic
1161427249 19:4210339-4210361 TCCGTTCCTTGTGCTGTTCCAGG - Exonic
1162312326 19:9914441-9914463 ACAATTTCGTCTGCTGGCCCTGG - Intronic
1162456218 19:10786614-10786636 ACAGAGCCAGCTGCTGTCCCTGG + Exonic
1162896378 19:13766845-13766867 ACTGTTCCTTCTGCTTCCCTGGG - Intronic
1163454934 19:17400917-17400939 ATGGTTCCTACTGCTGTCCCAGG - Intergenic
1167396550 19:49233171-49233193 CCAGTTCCTCCTGCTGTCAAAGG - Intergenic
1167815519 19:51877302-51877324 GCTGCTCCTTCTGCTATCCCTGG + Exonic
1168279539 19:55297416-55297438 ACAATTCCCTCAGCAGTCCCAGG + Intronic
1168352918 19:55686750-55686772 ACACTCCCTCCTGTTGTCCCTGG - Intronic
925028926 2:634313-634335 AGAGTGCCTGCTGCTATCCCTGG - Intergenic
925859499 2:8161154-8161176 ACAGTTCCTGTTTCTGTCCAGGG + Intergenic
926131752 2:10307393-10307415 ACAGTTCCTTCTACCTGCCCAGG + Intronic
926445365 2:12935315-12935337 AAAGTTCCTTCTTGTCTCCCAGG - Intergenic
926973663 2:18491739-18491761 TCTCTTCCTTCTGCTGTCCTTGG + Intergenic
930895793 2:56444549-56444571 ACAGTTCCTTCCATTCTCCCAGG - Intergenic
931300485 2:60973762-60973784 CAAGTTCCTACTCCTGTCCCGGG - Intronic
934856490 2:97733275-97733297 ACTGTCCCTTCTGCTCCCCCAGG + Exonic
935043406 2:99456522-99456544 GCAGTTCCTTCTGCTTCCTCAGG - Intronic
935833490 2:107024737-107024759 TCAGTTCCATCTGTTGCCCCAGG + Intergenic
938713204 2:133993208-133993230 TCAGCTCCTTCTGCTGGACCGGG - Intergenic
938760692 2:134423164-134423186 CCAGTTCCTGCTCCTGTGCCTGG - Intronic
939120562 2:138111111-138111133 ACATTTTTTTCTGTTGTCCCTGG - Intergenic
942689498 2:178570497-178570519 ACAGGTCCTTCAGGTGGCCCTGG + Exonic
943081875 2:183265891-183265913 CCATTTCCTTCTCCTTTCCCTGG + Intergenic
947543095 2:230991786-230991808 TCAGTCCCTCCTGCTGCCCCTGG - Intergenic
948403749 2:237702532-237702554 TCAGTTCCTGCTGCTGCCCGCGG - Intronic
1172053532 20:32138132-32138154 AGAGTTCTTTCTGTTGTCGCAGG + Intronic
1172197095 20:33099456-33099478 GCAGTGACTCCTGCTGTCCCAGG + Intronic
1172274151 20:33670712-33670734 ACAGTTCCTGCAGCTCCCCCAGG + Exonic
1175913998 20:62417252-62417274 TCAGTGTCTTCTGCTGTTCCCGG + Exonic
1176120526 20:63452635-63452657 CCCGTTCCTGCTGCAGTCCCAGG - Intronic
1179169497 21:38962000-38962022 AAAGTCCCTTCTGCTGTGTCAGG + Intergenic
1181541569 22:23575790-23575812 CAAGGTCCTTCTGCTGTACCTGG + Intronic
1181551444 22:23641127-23641149 CAAGGTCCTTCTGCTGTACCTGG + Intergenic
1181796816 22:25317515-25317537 CAAGGTCCTTCTGCTGTACCTGG - Intergenic
1183189211 22:36310954-36310976 ACAGTTGCTTCCGCAGCCCCAGG + Intronic
1183543761 22:38444651-38444673 ACTGTTCCTCCTGCTGTCTCTGG - Intronic
1184362577 22:44027080-44027102 ACAGTTCCCTTTTCTGACCCAGG - Intronic
1184663184 22:45974937-45974959 TCAGCTCCTTCTGCTGTCTATGG + Intronic
1185196106 22:49470503-49470525 ACATTTCCCTCTGGTGTCCTGGG - Intronic
1185269186 22:49920844-49920866 CCAGCCCCTGCTGCTGTCCCTGG + Intronic
951415720 3:22419166-22419188 ACAGCTCCTTCTGCTCCCGCAGG - Intergenic
952843854 3:37670296-37670318 ACCTTTCCTCCTGCTGTCCTAGG + Intronic
954317377 3:49808445-49808467 TCAGTTCCTTCTGCTGCTCAGGG + Exonic
955876206 3:63492441-63492463 ACATTTCCCTCTGTTCTCCCTGG - Intronic
956384686 3:68704062-68704084 ACAGGTCCTGCTCCTGTCCAAGG + Intergenic
957396046 3:79640016-79640038 ACACTTCTTACTTCTGTCCCTGG - Intronic
959163292 3:102744448-102744470 AAAGTCCCTTCTGCTGTGCAAGG + Intergenic
961003423 3:123389086-123389108 CCAGTTCCTTCTCCTGCCCAAGG - Intronic
961633511 3:128318500-128318522 CCTGTACCTTCTGCTGTCCTGGG - Intronic
961655661 3:128440306-128440328 ACAGTCCCTCCTGCTGCACCTGG + Intergenic
962271044 3:133978401-133978423 ACAGTCCCTTCTACGGTCCTAGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962868996 3:139472036-139472058 ACAGTGCCTTCTGGTGTCCCAGG + Intronic
962964859 3:140344247-140344269 ACAGCTCATTGTGCTGTGCCTGG + Intronic
964305244 3:155332664-155332686 CCAGTTGCATCTGCTGTGCCAGG + Intergenic
964313712 3:155421199-155421221 AGAGTCTCTTCTGCTGTTCCTGG + Intronic
964530164 3:157658841-157658863 ACAATGCTTTCTGCAGTCCCTGG + Intronic
967986095 3:195096266-195096288 ACAGATCCTCCTGCTGTGCATGG - Intronic
972195621 4:36650195-36650217 ACAGTTCCTTCTCTTGGTCCTGG - Intergenic
973809459 4:54556156-54556178 TCAGTGCCTTCTGCTATGCCTGG - Intergenic
975614803 4:76235453-76235475 AGAGTGCCTACTGCTGTCCCTGG - Intronic
977765621 4:100794630-100794652 ACATTTCTAGCTGCTGTCCCAGG + Intronic
978331999 4:107623600-107623622 CCAGTTCCTTCTCCTGTTCTAGG - Intronic
979621884 4:122807226-122807248 TCAGTTCATTCTGCTGTTTCCGG - Intergenic
980140485 4:128910131-128910153 ACAGATCCTTTTGCAGTTCCTGG - Intronic
986877855 5:12132601-12132623 ACACAGCCTTCTGTTGTCCCAGG + Intergenic
986890739 5:12301747-12301769 ACAGTTCCATATGCTGTACAGGG - Intergenic
992997215 5:82345592-82345614 TGAGGTCCTTCTGCTGGCCCAGG - Intronic
993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG + Intronic
997738311 5:136231123-136231145 CCAGTTCTTTCTGCTCTCGCTGG + Intronic
998462598 5:142320831-142320853 TCATTTCCTGCTCCTGTCCCAGG - Intronic
998920204 5:147059786-147059808 ATGGTTGCTTCTGCTCTCCCAGG - Intronic
1000836839 5:166165764-166165786 ACTGTACCGTCTGCTGTCCATGG + Intergenic
1001201571 5:169722445-169722467 ACAGATCCTCATGCTGCCCCAGG + Intronic
1001513639 5:172339955-172339977 ACCATTCCATCTGCTGGCCCTGG - Intronic
1001822002 5:174717956-174717978 ACAGTTCATTCTGGAGTCACCGG + Intergenic
1001956058 5:175848926-175848948 TCCTTTCCTTCTGCTCTCCCCGG - Intronic
1002943201 6:1735523-1735545 ACAGTTCCGTCTGCTTCTCCTGG - Intronic
1003865026 6:10355143-10355165 ATAGCACCTTTTGCTGTCCCCGG + Intergenic
1004051040 6:12079506-12079528 ACAGATGCTGCTGCTGCCCCTGG + Intronic
1005136180 6:22570956-22570978 ACAAATCCTTTTGCTGACCCAGG + Exonic
1005959251 6:30684520-30684542 ACAGTTGATGCTGCAGTCCCGGG - Exonic
1006848272 6:37078289-37078311 AAAGTGTCTTCAGCTGTCCCTGG + Intergenic
1007631151 6:43274429-43274451 ACAGCTCCTTCTGCCTACCCAGG - Intronic
1007833408 6:44655957-44655979 CCACTTCCGTCTTCTGTCCCTGG - Intergenic
1008375868 6:50790759-50790781 ACAATTTTTGCTGCTGTCCCAGG - Intergenic
1008514680 6:52307638-52307660 AGAGATCCTTCAGGTGTCCCGGG - Intergenic
1012387183 6:98695659-98695681 CCAGATTCTCCTGCTGTCCCAGG - Intergenic
1012763346 6:103332033-103332055 AGAGTTCCTTCTTCTCTGCCTGG + Intergenic
1012987150 6:105887290-105887312 ACAGTGGCTTCTGCTGTCAGAGG - Intergenic
1013009354 6:106105638-106105660 ACAGTGCCTTCTCCTTTACCGGG + Exonic
1013275275 6:108579172-108579194 ACAGTTCATTCTGCTGTTAGTGG + Intronic
1014537026 6:122626598-122626620 ACATTTCCTTTTGCTCTTCCTGG - Intronic
1015270916 6:131338230-131338252 AGAGTTGCTTCTGCTATACCCGG + Intergenic
1016822337 6:148358477-148358499 ACACTACCTTCTGGGGTCCCAGG + Intronic
1017422214 6:154284276-154284298 ACAATTCCTTCTGTTCTACCAGG - Intronic
1017835549 6:158174182-158174204 ACAGCTGCTTCCACTGTCCCAGG + Intronic
1017949667 6:159126192-159126214 ACAGCTGCTTTCGCTGTCCCAGG + Intergenic
1018432738 6:163735764-163735786 GCAGTGCCTTCAGCTGTCCAGGG + Intergenic
1019024050 6:168942580-168942602 GCAGTGCCTTCTGCTGGCCAAGG + Intergenic
1019428853 7:989287-989309 ACACTTCCTGCAGCTGTGCCTGG + Exonic
1021887882 7:25157760-25157782 TCATGTCCTTCTTCTGTCCCAGG - Intronic
1022139319 7:27479415-27479437 ATAGTTTCTTTTGCTGTCCAAGG - Intergenic
1022158134 7:27680801-27680823 CCAGGTCTTTCTGCTGTGCCAGG + Intergenic
1023094530 7:36646905-36646927 AAAATTCCTTTTGCTGTCCAAGG + Intronic
1023912628 7:44566506-44566528 CCAGTTCCTCCTGCTCTCCGTGG - Exonic
1026109082 7:67444569-67444591 ATAGTTCCTCCTTCTGTGCCAGG + Intergenic
1026309326 7:69170196-69170218 ACTATTGCTTCTGCTATCCCAGG - Intergenic
1027612037 7:80373699-80373721 AAATTTCCTCCTCCTGTCCCAGG + Intronic
1028011857 7:85655569-85655591 AAAGCTCCTTCTGCTATCCCAGG + Intergenic
1030905295 7:115174079-115174101 TCACTTCCTTCTGCAGTGCCAGG + Intergenic
1034254979 7:149719986-149720008 ACAGTTCCCTCTTCTTTCCCAGG + Exonic
1034832198 7:154319034-154319056 ACACCTCCTGCTGCTGGCCCTGG - Intronic
1038159086 8:25019606-25019628 ACATTCCCATCTGCTGTGCCTGG + Intergenic
1040997341 8:53415134-53415156 TCAGTTCCATCTGCTGTTCAGGG + Intergenic
1041128174 8:54666679-54666701 ACAATCCCAGCTGCTGTCCCGGG - Intergenic
1041845618 8:62324659-62324681 ATAGTTCTTTCTGCTTTTCCTGG - Intronic
1041986392 8:63926011-63926033 ACATTACGTTCTGCTGTCCTAGG + Intergenic
1043192329 8:77241435-77241457 ACTGTGCCTTCTAGTGTCCCTGG + Intergenic
1045300620 8:100907506-100907528 ACAGTTCCAGGTGCTGGCCCAGG + Intergenic
1045351319 8:101342899-101342921 ATTGTTTCTTCTGCTGACCCAGG + Intergenic
1048242799 8:132760743-132760765 ACATTCCCTGCTGCTGGCCCAGG - Intergenic
1048841351 8:138569381-138569403 CCAATTCTTCCTGCTGTCCCTGG + Intergenic
1048861285 8:138726085-138726107 ACAGTACCTGCTTCTGTTCCTGG - Intronic
1049293050 8:141814063-141814085 ACAGTTCCTTCCTCTCTCCTGGG + Intergenic
1050325919 9:4496963-4496985 ACACTGTCTTCTACTGTCCCAGG - Intronic
1050596882 9:7212994-7213016 ACAGTCCCTTCTTTTTTCCCCGG + Intergenic
1052776745 9:32740228-32740250 ACAGTTCCTTCTGTAGCCTCTGG - Intergenic
1054755559 9:68954030-68954052 TCAATTGCTTCTGGTGTCCCTGG + Intronic
1058147216 9:101425452-101425474 ACTGTTCCTGCAGCTGTTCCTGG - Exonic
1058869142 9:109187592-109187614 ACAGTTCCCACTACTGCCCCAGG + Intronic
1061664374 9:132151883-132151905 AGAGGTCCTGCTGCTGTGCCAGG + Intergenic
1062034968 9:134378944-134378966 AGAGGTCCTGCTGCTGTCCTCGG + Intronic
1062472755 9:136713433-136713455 AGGGTTCCTCCTGCTGACCCAGG - Intronic
1062682450 9:137789080-137789102 TCATTTCCTTCTGCTTACCCGGG + Intronic
1186352257 X:8751782-8751804 ACAATTCCTCCTGCTGTCAATGG + Intergenic
1188859901 X:35244212-35244234 ACACTTCCTGCTGCAGTCCATGG + Intergenic
1189288308 X:39867501-39867523 CCAGTCCCTTCAACTGTCCCTGG + Intergenic
1190232474 X:48592971-48592993 ACAGATACTTCTTCAGTCCCTGG - Intronic
1191222090 X:57999951-57999973 TCAGTTCATTCTGCTGTCAAAGG - Intergenic
1191256729 X:58282702-58282724 GCAGTTCCTGCTCCTGACCCGGG - Intergenic
1198705503 X:139443869-139443891 TCTGTTCCTTCTTCTGGCCCAGG - Intergenic
1200150734 X:153950172-153950194 ACAGTTCCTCCTGCTGCACCCGG + Intronic
1200915372 Y:8566757-8566779 ACACTTGCTTCTACTGTCTCAGG + Intergenic