ID: 993698352

View in Genome Browser
Species Human (GRCh38)
Location 5:91089078-91089100
Sequence CAATACCCACAGGTGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 1, 1: 0, 2: 7, 3: 265, 4: 645}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993698352_993698356 -6 Left 993698352 5:91089078-91089100 CCCTGCCACACCTGTGGGTATTG 0: 1
1: 0
2: 7
3: 265
4: 645
Right 993698356 5:91089095-91089117 GTATTGTGCCATTGTTTAAAAGG 0: 1
1: 0
2: 1
3: 168
4: 9763
993698352_993698357 -5 Left 993698352 5:91089078-91089100 CCCTGCCACACCTGTGGGTATTG 0: 1
1: 0
2: 7
3: 265
4: 645
Right 993698357 5:91089096-91089118 TATTGTGCCATTGTTTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993698352 Original CRISPR CAATACCCACAGGTGTGGCA GGG (reversed) Intronic
900201704 1:1410736-1410758 AAACACCCACAGGTGTGGAGGGG + Intergenic
900234511 1:1581214-1581236 AAACACCCACAGGTGTGGAGGGG + Intergenic
900654824 1:3751354-3751376 AAATACCCACAGGTGTGGATGGG + Intergenic
900907895 1:5573616-5573638 ATATACCCACAGGTGTGGAGGGG - Intergenic
901398919 1:9002773-9002795 AAATACCCACAGGTGTCGAGGGG + Intergenic
901401965 1:9020798-9020820 AAATTCCCACATGTGTGGGAGGG + Intronic
901601668 1:10427589-10427611 AAACACCCACAGGTGTGGAGGGG + Intergenic
901830808 1:11891123-11891145 AAATACCCACAGGTGTGGAGGGG + Intergenic
901955849 1:12784963-12784985 AAATACCCACAGGTGTGGAGTGG - Intergenic
901979223 1:13021011-13021033 AAATACCCACAGGTGTGGAGTGG - Intronic
901987437 1:13087072-13087094 GTATACCCACAGGTGTGGAGGGG + Intergenic
901994375 1:13139695-13139717 GTATACCCACAGGTGTGGAGGGG - Intergenic
902002859 1:13207927-13207949 AAATACCCACAGGTGTGGAGTGG + Intergenic
902022086 1:13353691-13353713 AAATACCCACAGGTGTGGAGTGG + Intergenic
902248135 1:15135353-15135375 AAACACCCACAGGTGTGGAGGGG - Intergenic
903746253 1:25588780-25588802 AAACACCCACAGGTGTGGAGGGG + Intergenic
904269177 1:29338097-29338119 AAACACCCACAGGTGTGGAGGGG - Intergenic
904272606 1:29360253-29360275 AAACACCCACAGGTGTGGAGGGG + Intergenic
904314962 1:29654031-29654053 CAATTCACCAAGGTGTGGCAGGG + Intergenic
904797071 1:33064447-33064469 AAACACCCACAGGTGTGGAGGGG + Intronic
904797558 1:33068655-33068677 AAACACCTACAGGTGTGGAAGGG + Intronic
905227538 1:36488999-36489021 AAACACCCACAGGTGTGGAGGGG - Intergenic
905380733 1:37559688-37559710 AAATACCCACAGGTGTGGAGGGG - Intronic
905628389 1:39504147-39504169 AAATACCCACAGGCGTGGAGGGG - Intronic
905628455 1:39504614-39504636 AAATACCCACAGGTGTGGAGGGG - Intronic
905751917 1:40472720-40472742 AAATACCCACAGGTGTAGAGGGG + Intergenic
905762648 1:40572957-40572979 AAACACCCACAGGTGTGGAGGGG + Intergenic
906404257 1:45529031-45529053 AAACACCCACAGGTGTGGAGGGG + Intergenic
906508290 1:46395877-46395899 AAATACCCACAGGTGTGGAGGGG - Intronic
906601591 1:47134166-47134188 AAATACCCACAGGTGTGGAGGGG + Intergenic
907120906 1:52007174-52007196 AAACACCCACAGGTGTGGAGGGG + Intergenic
907254485 1:53168252-53168274 AAATACCCACAGGTGTGGAGGGG - Intergenic
907465839 1:54636136-54636158 AAACACCCACAGGTGTGGAGGGG - Exonic
908022760 1:59915331-59915353 AAATACCCATAGGTGTGGAAGGG + Intronic
908024661 1:59938172-59938194 AAATACCCACAGGTGTGGAGGGG - Intergenic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
908543186 1:65140725-65140747 AAACACCCACAGGTGTGGAGGGG + Intergenic
908674787 1:66591581-66591603 AAACACCCACAGGTGTGGAGGGG - Intronic
909234030 1:73129313-73129335 AAACACCCACAGGTGTGGAGGGG - Intergenic
909651710 1:77982911-77982933 AAACACCCACAGGTGTGGAGGGG - Intronic
910604298 1:89066878-89066900 AAACACCCACAGGTGTGGAGGGG - Intergenic
911531017 1:99043119-99043141 AAATATCCACAGGTGTGGAGGGG + Intergenic
911595382 1:99793570-99793592 AAATACCCACAGGTGTGGAGGGG - Intergenic
912301137 1:108518375-108518397 AAACACCCACAGGTGTGGAGGGG + Intergenic
912450969 1:109767579-109767601 AAATACCCACAGGTGTGGAGGGG + Intronic
912642357 1:111359736-111359758 AAACACCCACAGGTGTGGAGGGG - Intergenic
912642578 1:111361431-111361453 AAATACCCACAGATGTGGAGGGG - Intergenic
912814311 1:112816793-112816815 AAATACCCACAGGTGTGGAGGGG - Intergenic
912942684 1:114059083-114059105 AAACACCCACAGGTGTGGAGGGG + Intergenic
914358224 1:146907227-146907249 AAACACCCACAGGTGTGGAGGGG - Intergenic
914393264 1:147241030-147241052 AAATACCCACAAGTGTGGAGGGG + Intronic
914441256 1:147709423-147709445 AAATACCCACAGGTGTGGAGGGG - Intergenic
914443968 1:147733857-147733879 AAACACCCACAGGTGTGGAGGGG - Intergenic
914495201 1:148189780-148189802 AAACACCCACAGGTGTGGAGGGG + Intergenic
914589354 1:149092892-149092914 AAATGCCCACAGGTGTGGAGGGG - Intronic
914773204 1:150710176-150710198 AAATACCCACAGGTGTGGAGGGG + Intronic
914924617 1:151873460-151873482 AAACACCCACAGGTGTGGAGGGG + Intergenic
914985664 1:152455124-152455146 AAACACCCACAGGTGTGGAGGGG - Intergenic
915027418 1:152843801-152843823 TAGTACCCAAAGGTGGGGCAGGG - Exonic
915397854 1:155599552-155599574 AAACACCCACAGGTGTGGAGGGG - Intergenic
915480645 1:156182384-156182406 AAACACCCACAGGTGTGGAGGGG + Intergenic
915890492 1:159768726-159768748 AAACACCCACAGGTGTGGAGGGG + Intergenic
916009471 1:160691716-160691738 AAACACCCACAGGTGTGGAGGGG + Intronic
916010362 1:160699979-160700001 AAACACCCACAGGTGTGGAGGGG + Intronic
916035020 1:160914085-160914107 AAACACCCACAGGTGTGGAGAGG + Intergenic
916039072 1:160946917-160946939 AAATACCCACAGATGTGGAGGGG - Intronic
916039317 1:160948840-160948862 GAACACCCACAGGTGTGGAGGGG - Intronic
916048364 1:161017767-161017789 AAACACCCACAGGTGTGGAGGGG + Intronic
916092128 1:161315723-161315745 AAACACCCACAGGTGTGGAGGGG - Intronic
916103601 1:161413585-161413607 AAATACCCACAGGTGTGGAGGGG + Intergenic
916106268 1:161434889-161434911 AAATACCCACAGGTGTGGAGGGG + Intergenic
916630266 1:166605379-166605401 AAATACCCACAGGTGTGGAGGGG - Intergenic
916630765 1:166610045-166610067 AAATACCCACAGGTGTGGACGGG - Intergenic
919326046 1:196108747-196108769 AAATGCCCACAGGTGTGGAGAGG - Intergenic
919484442 1:198129697-198129719 AAATACCCACAGGTGTGGAGGGG - Intergenic
919771062 1:201158868-201158890 CCAGACCCACAGCTGTGGCACGG - Intronic
921019345 1:211222147-211222169 AAATGCCCACAGGTGTGGAGGGG - Intergenic
921821117 1:219618592-219618614 ATATACCCACAGGTGTGGAGCGG - Intergenic
922398478 1:225226616-225226638 AAATACCCACAGGTGTGGAGGGG - Intronic
922484968 1:225966821-225966843 AAATACCCACAGGTGTGGAGGGG + Intergenic
922681919 1:227606029-227606051 AAATACCCACCGGTGTGGAGGGG - Intronic
923226372 1:231942110-231942132 CAAAACCTTCAGGTGGGGCATGG - Intronic
923725937 1:236505489-236505511 AAATATCCACAGGTGTGGAGGGG + Intergenic
923936102 1:238762310-238762332 AAATACCCACAGGTGTGGAGGGG - Intergenic
924162518 1:241247420-241247442 AAATACCCACAGGTGTGGAGCGG - Intronic
924764092 1:247015798-247015820 AAACACCCACAGGTGTGGAGGGG - Intergenic
924829963 1:247582963-247582985 AAATACCCACAGATGTGGAGGGG + Intergenic
1063114207 10:3062403-3062425 AAACACCCACAGGTGTGGAGGGG + Intergenic
1063306167 10:4902970-4902992 AAATACCCACAGGTGTGGAGGGG - Intergenic
1063453152 10:6164498-6164520 AAACACCCACAGGTGTGGAGGGG - Intronic
1063530247 10:6824194-6824216 AAACACCCACAGGTGTGGAGGGG - Intergenic
1063531173 10:6832689-6832711 AAACACCCACAGGTGTGGAGGGG - Intergenic
1064525449 10:16250942-16250964 AAATACCCACAGGTATGGAGGGG + Intergenic
1065809416 10:29427703-29427725 AAATACCCACAGGTGTGGAAGGG + Intergenic
1066175135 10:32895446-32895468 AAATACCCACAAGTGTGGAGGGG + Intergenic
1066635360 10:37494270-37494292 AAACACCCACAGGTGTGGAGGGG + Intergenic
1067574096 10:47396863-47396885 AAATACCCTCAGGTGTGGAGGGG - Intergenic
1069184753 10:65409245-65409267 AAACACCCACAGGTGTGGAGGGG - Intergenic
1069452165 10:68526599-68526621 AAACACCCACAGGTGTGGAGGGG + Intronic
1069677379 10:70258184-70258206 AAATACCCACAGGTGTGGAGAGG + Intronic
1070870319 10:79745555-79745577 AAATACCCACAGCTGTGGAGGGG + Intergenic
1070998390 10:80806874-80806896 AAATACCCACAGGTGTGGAGGGG + Intergenic
1071637237 10:87267775-87267797 AAATACCCACAGCTGTGGAGGGG + Intergenic
1071658009 10:87470179-87470201 AAATACCCACAGCTGTGGAGGGG - Intergenic
1071916758 10:90301668-90301690 AAAAACCCACAGGTGTGGAGGGG - Intergenic
1072207415 10:93216563-93216585 CAAATCACACAGGAGTGGCATGG - Intergenic
1072410433 10:95197209-95197231 AAATACCCACAGATGTGGAGGGG - Intronic
1072541844 10:96404231-96404253 AAATACCCACAGGTGTGGAGGGG + Intronic
1072708648 10:97700809-97700831 AAATACCCACAGGTGTGGAGGGG + Intergenic
1072747349 10:97950201-97950223 CAAAACCAACAGCTGTGTCATGG - Intronic
1072875258 10:99165835-99165857 CAAAACCCACAGGACTGGCTGGG - Intronic
1072947213 10:99820827-99820849 AAACACCCACAGGTGTGGAGGGG - Intronic
1073106230 10:101033548-101033570 AAATACCCACAGGTGTGGAGGGG - Intronic
1073286434 10:102392359-102392381 AAACACCCACAGGTGTGGAGGGG + Intergenic
1073298253 10:102454390-102454412 AAAAACCCACAGGTGTGGAGGGG - Intergenic
1075079452 10:119373344-119373366 TAATTCCCACATGTGTGGGAGGG + Intronic
1075370392 10:121929948-121929970 AAACACCCACAGGTGTGGAGGGG - Intergenic
1076856208 10:133116592-133116614 CTCTCCCCCCAGGTGTGGCAGGG + Intronic
1076940232 10:133600486-133600508 AAATACCCACAGGTGTGGAGGGG + Intergenic
1076941302 10:133611143-133611165 AAATACCCACAGGTGTGGAGGGG + Intergenic
1076980613 11:202669-202691 AAATACCCACAGGTGTGGAGAGG + Intronic
1077347765 11:2072056-2072078 TAAGACCCACAGGTCTGGCCTGG + Intergenic
1077529525 11:3088612-3088634 CCATAACCACAGGGGTGGGAGGG - Intronic
1077585356 11:3447441-3447463 AAATACCCACAGGTGTGGAAGGG - Intergenic
1077586268 11:3455968-3455990 AAATACCGACAGGTGTGGAGGGG - Intergenic
1077597456 11:3546338-3546360 AAATACCCACAGGTGTGGAGGGG + Intergenic
1077603854 11:3593674-3593696 AAATACCCACAGGTGTGGAGGGG - Intergenic
1077703072 11:4459448-4459470 AAATACCCACAGGTGTGGAGGGG - Intergenic
1077703189 11:4460481-4460503 AAATACCCACAGGTGTGGAGGGG - Intergenic
1078216843 11:9318791-9318813 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1078327325 11:10391324-10391346 AAACACCCACAGGTGTGGAGGGG - Intronic
1079664849 11:23092518-23092540 AAATACCCACAGGTATGGAGGGG - Intergenic
1079770060 11:24447015-24447037 AAACACCCACAGGTGTGGAGGGG + Intergenic
1079851528 11:25541690-25541712 AAATACTCACAGGTGTGGAGGGG + Intergenic
1080940751 11:36914886-36914908 CTATACCCAGAGGTTTGGAAGGG - Intergenic
1081014596 11:37859864-37859886 AAACACCCACAGGTGTGGAGGGG + Intergenic
1082621783 11:55431922-55431944 AAACACCCACAGGTGTGGAGGGG + Intergenic
1082706809 11:56502595-56502617 AAATACCCACAGGTGTGGAGGGG - Intergenic
1082969628 11:59005688-59005710 AAATACCCACAGGTGTGGAGGGG + Intronic
1082982605 11:59137240-59137262 AATTACCCACAGGTGTGGAGGGG + Intergenic
1083146107 11:60760071-60760093 AAATACCCACAGGTGTGGAGGGG + Intronic
1083285321 11:61655028-61655050 AAACACCCACAGGTGTGGAGGGG - Intergenic
1083372873 11:62195591-62195613 AAACACCCACAGGTGTGGAGGGG + Intergenic
1083375499 11:62216904-62216926 AAATACCCACAGGTGTGGAGGGG + Intergenic
1083392966 11:62368506-62368528 AAACACCCACAGGTGTGGAGGGG - Intronic
1083467716 11:62859851-62859873 AAATACCCACAGGTGTGGAGGGG - Intronic
1083543038 11:63527986-63528008 AAACACCCACAGGTGTGGAGGGG - Intergenic
1083875736 11:65523730-65523752 AAATACCCACAGGTGTGGAGGGG + Intergenic
1084231782 11:67758812-67758834 AAATGCCCACAGGTGTGGAGTGG + Intergenic
1084242261 11:67830000-67830022 AAATACCCACAGGTGTGGAGGGG - Intergenic
1084247316 11:67867979-67868001 AAACACCCACAGGTGTGGAGGGG - Intergenic
1084253561 11:67922243-67922265 AAATACCCACAGGTGTGGAGGGG + Intergenic
1084259749 11:67968263-67968285 AAATACTCACAGGTGTGGAGGGG - Intergenic
1084783336 11:71425797-71425819 CAAGAACCACAGGTGTGGACAGG - Intergenic
1084799794 11:71535659-71535681 AAATACCCACAGGTGTGGAGGGG + Intronic
1084813016 11:71626989-71627011 AAATACCCACAGGTGTGGAGGGG + Intergenic
1084819321 11:71673683-71673705 AAATACCCACAGGTGTGGAGGGG - Intergenic
1085463983 11:76712075-76712097 AAATACCCACAGGTGTGGAGGGG + Intergenic
1087034815 11:93744710-93744732 AAATACCCACAGGTGTGGAGGGG - Intronic
1088858465 11:113778019-113778041 AAATACCCACAGGTGTGGAGGGG + Intergenic
1089300841 11:117497798-117497820 CAAATCCCACAGCTGTGGCAGGG + Intronic
1089471137 11:118721030-118721052 AAACACCCACAGGTGTGGAGGGG - Intergenic
1089472032 11:118729222-118729244 AAACACCCACAGGTGTGGAGGGG - Intergenic
1089512399 11:119008117-119008139 AAATACCCACAGGTGTGGAGGGG - Intronic
1091749575 12:3014078-3014100 CAAGCCCCACAGCTGTGGCCTGG + Intronic
1092234447 12:6797416-6797438 AAATACCCACAGGTGTGGAGGGG - Intronic
1092249609 12:6885875-6885897 AAACACCCACAGGTGTGGAGGGG - Intronic
1092405757 12:8221170-8221192 AAACACCCACAGGTGTGGAGGGG + Intergenic
1092412506 12:8264699-8264721 AAATACCCACAAGTGTGGAGGGG - Intergenic
1092431053 12:8409233-8409255 AAATACCCACAGGTGTGGAGAGG - Intergenic
1092433948 12:8431422-8431444 AAATACCCACAGGTGTGGAGGGG - Intergenic
1092437606 12:8462862-8462884 AAACACCCACAGGTGTGGAGGGG + Intronic
1092645840 12:10571283-10571305 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1092670172 12:10853450-10853472 CAGTGCTCACAGGTGTAGCAGGG - Intronic
1094389280 12:29932069-29932091 AAACACCCACAGGTGTGGAGGGG - Intergenic
1094815568 12:34180288-34180310 AAATACCCACAGGTGTGGAGGGG - Intergenic
1095450933 12:42329792-42329814 AAACACCCACAGGTGTGGAGGGG - Intronic
1095456211 12:42388674-42388696 ATATACCCACAGGTGTGGAGGGG + Intronic
1096125518 12:49116636-49116658 AAATACCCACAGGTGTGGAGGGG + Intergenic
1097132520 12:56823098-56823120 AAATACCCACAGTTGTGGAGGGG + Intergenic
1097149850 12:56968608-56968630 AAATACCCACACGTGTGGAGGGG - Intergenic
1097399232 12:59109147-59109169 AAACACCCACAGGTGTGGAGGGG + Intergenic
1098130756 12:67347605-67347627 TAATACCTGCAGGTGTGGGAAGG - Intergenic
1098654659 12:73013095-73013117 TAATACCCAAAGGTGGGCCAAGG + Intergenic
1098680488 12:73347947-73347969 AAATACCCACAGGTGTGGAGGGG - Intergenic
1098838131 12:75445782-75445804 AAATACCCACAGGTGTGGAGAGG + Intergenic
1100276378 12:93075332-93075354 AAACACCCACAGGTGTGGAGGGG + Intergenic
1101520572 12:105478574-105478596 AAACACCCACAGGTGTGGAGGGG - Intergenic
1101563171 12:105879540-105879562 CCATACCTGCAGGTGTGGAATGG - Intergenic
1101779979 12:107826469-107826491 AAACACCCACAGGTGTGGAGAGG - Intergenic
1101798178 12:107997051-107997073 AAATACCCCCAGGTGTGGAGGGG - Intergenic
1103092447 12:118106906-118106928 AAACACCCACAGGTGTGGAGGGG + Intronic
1103794396 12:123493536-123493558 AAACACCCACAGGTGTGGAGGGG + Intronic
1104176716 12:126340335-126340357 TAATACACACATGTGTGGGAGGG - Intergenic
1104238024 12:126958690-126958712 AAATACCCACAGGTGTGGACGGG - Intergenic
1104459575 12:128944501-128944523 CAATGCCCACAGTTGTGGGAGGG + Intronic
1104551815 12:129764034-129764056 CAATACTCAAAGCTGGGGCATGG - Intronic
1104564591 12:129869318-129869340 CAATGCCCCCAGGTATGCCAAGG - Intronic
1104749894 12:131231730-131231752 CATTACCCACAGATGTCACACGG + Intergenic
1105055009 12:133090551-133090573 AAATACCCACAGGTGTGGAGGGG - Intronic
1105055538 12:133095487-133095509 AAATACCCACAGGTGTGGAGGGG - Intronic
1105209945 13:18251882-18251904 AAACACCCACAGGTGTGGAGGGG + Intergenic
1105253329 13:18720880-18720902 AAACACCCACAGGTGTGGAGGGG + Intergenic
1105349206 13:19601148-19601170 AAACACCCACAGGTGTGGAGGGG + Intergenic
1105879601 13:24592493-24592515 AAACACCCACAGGTGTGGAGGGG + Intergenic
1105920238 13:24956561-24956583 AAACACCCACAGGTGTGGAGGGG - Intergenic
1106635696 13:31526205-31526227 AAATATCCACAAATGTGGCAGGG - Intergenic
1107667915 13:42711766-42711788 AAATACTCACAGGTGTGGAGGGG + Intergenic
1107821189 13:44287124-44287146 CAATACCCTGAGGTGTTGCGGGG - Intergenic
1109959728 13:69614893-69614915 AAACACCCACAGGTGTGGAGGGG - Intergenic
1110710717 13:78647752-78647774 AAATACCCACAGGTGTGGAGGGG + Intronic
1112007807 13:95268966-95268988 AAACACCCACAGGTGTGGAGGGG + Intronic
1112367197 13:98765314-98765336 AAATACCCACAGGTGTGGAGGGG + Intergenic
1112546878 13:100379820-100379842 TAATTCCCACATGTGTGGGAAGG - Intronic
1113509028 13:110837247-110837269 AAATACCCACAGGTGTGGAGGGG - Intergenic
1113970092 13:114181926-114181948 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114006625 14:18320438-18320460 AAATACCCACAGATGTGGAGGGG + Intergenic
1114167973 14:20241571-20241593 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114170675 14:20269853-20269875 AAACACCCACAGGTGTGGAGGGG + Intronic
1114438068 14:22724700-22724722 AAACACCCACAGGTGTGGAGGGG - Intergenic
1114603169 14:23972586-23972608 AAATACCCACAGGTGTGGAGGGG - Intronic
1114604013 14:23981507-23981529 AAATACCCACAGGTGTGGAGGGG - Intronic
1114607535 14:24009711-24009733 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114608147 14:24015067-24015089 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114609031 14:24024312-24024334 AAATACCCACAGGTGTGGAGGGG - Intergenic
1114969281 14:28005536-28005558 CAGTACGCACATGTGTGGGAGGG - Intergenic
1115000598 14:28416424-28416446 AAATACCCAAAGGTGTGGAGGGG + Intergenic
1115208385 14:30939070-30939092 CAAGTCCCACAAGGGTGGCAAGG + Intronic
1115623025 14:35159463-35159485 CAATAGCCAGATGTGTGCCAGGG - Intronic
1115888263 14:37998384-37998406 CAGAACCCACTGGTGTGGTATGG - Intronic
1115898607 14:38119030-38119052 AAACACCCACAGGTGTGGAGGGG + Intergenic
1116464406 14:45214653-45214675 AAATGCCCACAGGTGTGGAGGGG + Intronic
1116481368 14:45394541-45394563 AAATGCCCACAGGTGTGGAGGGG + Intergenic
1117335339 14:54752620-54752642 AAATACCCACAGGTGTGGAGGGG - Intronic
1117641821 14:57808075-57808097 CATTATCCCCAGGTGTGTCATGG - Intronic
1118601115 14:67472059-67472081 CAATGCCCATGAGTGTGGCAGGG + Exonic
1119823065 14:77635292-77635314 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1119826536 14:77661413-77661435 AAACACCCACAGGTGTGGAGGGG - Intergenic
1119841241 14:77794689-77794711 AAACACCCACAGGTGTGGAGGGG - Intergenic
1120733197 14:88025271-88025293 AAACACCCACAGGTGTGGAGGGG + Intergenic
1121195742 14:92069904-92069926 CCATACCTACAGGGGTGCCATGG + Intronic
1121295669 14:92819995-92820017 ATATACCCACAGGTGTGGAGGGG - Intronic
1121527148 14:94627106-94627128 AAATACCCATAGGTGTGGAGGGG + Intergenic
1122997687 14:105274437-105274459 ATATACCCACAGGTGTGGAGGGG + Intronic
1123052513 14:105552617-105552639 AAATACCCACAGGTGTGGAGGGG - Intergenic
1123052934 14:105555770-105555792 AAATACCCACAGGTGTGGAGGGG + Intergenic
1123077516 14:105676169-105676191 AAATACCCACAGGTGTGGAGGGG + Intergenic
1123136377 14:106031244-106031266 GAATACCCACAGGTGTGGAGGGG - Intergenic
1123178765 14:106447292-106447314 AAATACCCACAGTTGTGGAGGGG - Intergenic
1202919277 14_KI270723v1_random:16018-16040 AAACACCCACAGGTGTGGAGGGG - Intergenic
1123390557 15:19867074-19867096 AAGTACCCACAGGTGTGGAGGGG + Intergenic
1124927713 15:34087858-34087880 AAAAACCCACAGGTGGGGCCAGG + Intronic
1125562246 15:40643967-40643989 AAATACCCACAAGTGTGGAGGGG - Intronic
1126003006 15:44229576-44229598 AAATACCCACAGGTGTGGAGGGG + Intergenic
1126289127 15:47052201-47052223 GAATTCCCACATGTGTGGGAGGG - Intergenic
1127423560 15:58833357-58833379 AAACACCCACAGGTGTGGAGGGG - Intronic
1128130930 15:65226557-65226579 AAACACCCACAGGTGTGGAGGGG - Intergenic
1128194036 15:65734584-65734606 AAACACCCACAGGTGTGGAGGGG + Intronic
1128511479 15:68316350-68316372 TAATGCCCCCAGGTGGGGCAGGG - Intronic
1128649135 15:69397705-69397727 AAATACCCACAGGTGTGGAGGGG - Intronic
1129080068 15:73031941-73031963 CCCTCCCCACAGCTGTGGCAAGG + Intergenic
1129485788 15:75870869-75870891 AAACACCCACAGGTGTGGAGGGG - Intronic
1129773853 15:78221066-78221088 AAATACCCAGAGGTGTGGAGGGG - Intronic
1129987943 15:79935261-79935283 AAATACCCACAGGTGTGGAGGGG - Intergenic
1131194741 15:90346576-90346598 AAATACCCACAGGTGTGGAGGGG - Intergenic
1131275078 15:90974033-90974055 AAATACCCACAGGTGTGGAGGGG + Intronic
1131774929 15:95784736-95784758 AAACACCCACAGGTGTGGAAGGG - Intergenic
1131946605 15:97629117-97629139 AAATACCCACAGGTGTGGAGGGG - Intergenic
1132440512 15:101859992-101860014 AAACACCCACAGGTGTGGAGGGG - Intergenic
1132831726 16:1931820-1931842 AAATACCCACAGGTGTGGAGGGG + Intergenic
1133930023 16:10224422-10224444 CACAACCCACAGGTGGGGCTGGG + Intergenic
1134007772 16:10829464-10829486 AAATACCCACAGGTGTGGAGGGG - Intergenic
1134483222 16:14636162-14636184 AAACACCCACAGGTGTGGAGGGG - Intronic
1135577938 16:23600406-23600428 AAACACCCACAGGTGTGGAGGGG + Intergenic
1136183004 16:28567617-28567639 CATTAAGCACAGGTGTGGTAAGG + Intronic
1136355288 16:29741190-29741212 AAATACCCACAGGTGTGGAGGGG + Intergenic
1136710227 16:32230805-32230827 AAATACCCACAGGTGTGGAGGGG + Intergenic
1136757684 16:32698606-32698628 AAATACCCACAAGTGTGGAGGGG - Intergenic
1136810422 16:33171769-33171791 AAATACCCACAAGTGTGGAGGGG + Intergenic
1136816898 16:33281849-33281871 AAATACCCACAAGTGTGGAGGGG + Intronic
1136911097 16:34145061-34145083 AAATACCCACAAGTGTGGAGGGG + Intergenic
1136930287 16:34412072-34412094 AAACACCCACAGGTGTGGAGGGG - Intergenic
1136974287 16:34999734-34999756 AAACACCCACAGGTGTGGAGGGG + Intergenic
1136991549 16:35154419-35154441 AAATACCCACAGGTGTGGAGGGG + Intergenic
1136998169 16:35205547-35205569 AAATACCCACAGGTGTGGAGGGG + Intergenic
1137042910 16:35629770-35629792 AAATACCCACAGTTGTGGAGGGG + Intergenic
1137075408 16:35955570-35955592 AAACACCCACAGGTGTGGAGGGG - Intergenic
1138615535 16:58162680-58162702 AAGTCCCCACAGCTGTGGCATGG + Intronic
1139439065 16:66955390-66955412 ATATACCCACAGGTGTGGAGGGG - Intergenic
1139706925 16:68747245-68747267 GGGTACCCAAAGGTGTGGCAGGG + Intronic
1139830684 16:69795443-69795465 CAATAGCCACATGTGTCTCATGG + Intronic
1140546485 16:75815020-75815042 AAACACCCACAGGTGTGGAGGGG - Intergenic
1141416448 16:83879199-83879221 AAATACCCACAGGTGTGGAGGGG - Intergenic
1141702704 16:85649878-85649900 CTATCCCCAGAGGTGTGGGAAGG + Intronic
1203059833 16_KI270728v1_random:958955-958977 AAATACCCACAGGTGTGGAGGGG - Intergenic
1143195691 17:5074695-5074717 AAACACCCACAGGTGTGGAGGGG - Intergenic
1143401466 17:6647325-6647347 AAATACCCACAGGTGTGGAGGGG + Intronic
1143459181 17:7089599-7089621 AAACACCCACAGGTGTGGAGGGG + Intergenic
1143469039 17:7160022-7160044 AAATACTCACAGGTGTGGAGGGG + Intergenic
1144745422 17:17610943-17610965 AAACACCCACAGGTGTGGAGGGG - Intergenic
1144861237 17:18303905-18303927 AAATACCCACAGGTGTGGAGGGG + Intronic
1144882482 17:18437821-18437843 AAACACCCACAGGTGTGGAGGGG + Intergenic
1145149752 17:20506565-20506587 AAACACCCACAGGTGTGGAGGGG - Intergenic
1146166589 17:30594457-30594479 AAATACCCACAGGTGTGGAGGGG - Intergenic
1146181345 17:30700056-30700078 AAACACCCACAGGTGTGGAGGGG - Intergenic
1146839559 17:36140987-36141009 AAACACCCACAGGTGTGGAGGGG + Intergenic
1147541475 17:41363837-41363859 TAGTACCCAAAGGTGTTGCAAGG + Exonic
1147838842 17:43355876-43355898 AAACACCCACAGGTGTGGAGGGG + Intergenic
1148273636 17:46283629-46283651 AAACACCCACAGGTGTGGAGGGG - Intronic
1149202438 17:54202504-54202526 AAACACCCACAGGTGTGGAGGGG + Intergenic
1150409424 17:64930946-64930968 AAACACCCACAGGTGTGGAGGGG + Intergenic
1150686706 17:67326861-67326883 AAACACCCACAGGTGTGGAGGGG - Intergenic
1150840838 17:68604007-68604029 AAACACCCACAGGTGTGGAGGGG - Intergenic
1151427524 17:74040679-74040701 CAGTCCCCACAGGTGTTCCAAGG - Intergenic
1152480824 17:80551223-80551245 AAACACCCACAGGTGTGGAGGGG - Intronic
1152559957 17:81072990-81073012 CAATACCCAGGGCTGTGGGAAGG - Intronic
1152869505 17:82744547-82744569 AAACACCCACAGGTGTGGAGGGG - Intronic
1153422009 18:4917294-4917316 AAACACCCACAGGTGTGGAGGGG - Intergenic
1153681086 18:7501594-7501616 CAGGTCCCACAGGTGAGGCAGGG + Intergenic
1154368503 18:13733975-13733997 TAATTCCCACATGTGTGGGAGGG + Intronic
1154530841 18:15343762-15343784 AAGTACCCACAGGTGTGGAGGGG - Intergenic
1154926371 18:20940937-20940959 GAATTCCCACATGTGTGGGAGGG + Intergenic
1155472042 18:26201850-26201872 AAACACCCACAGGTGTGGAGGGG - Intergenic
1155942301 18:31811445-31811467 AAACACCCACAGGTGTGGAGGGG + Intergenic
1156806176 18:41184800-41184822 AAACACCCACAGGTGTGGAGCGG + Intergenic
1156825370 18:41424665-41424687 TAATTCCCACATGTGTGGGAGGG + Intergenic
1157250263 18:46089264-46089286 AAATACTCACAGGTGTGGAGGGG + Intronic
1157250291 18:46089390-46089412 AAATACCCACAGGTGTGGAGGGG + Intronic
1157777101 18:50404208-50404230 AAACACCCACAGGTGTGGAGGGG - Intergenic
1158588117 18:58758285-58758307 CCATAGGCAGAGGTGTGGCATGG - Intergenic
1159091412 18:63853297-63853319 AAATACCCACAGGTGTGGAAAGG + Intergenic
1159336649 18:67076798-67076820 AAACACCCACAGGTGTGGAGGGG - Intergenic
1159412940 18:68105257-68105279 AAACACCCACAGGTGTGGAGGGG - Intergenic
1159484849 18:69042867-69042889 AAACACCCACAGGTGTGGAGGGG - Intronic
1159606533 18:70480110-70480132 AAATACCCACGGGTGTGGTGGGG + Intergenic
1160655064 19:262013-262035 AAATACCCACAGGTGTGGAGGGG + Intergenic
1161362652 19:3859664-3859686 CATTAGCCTCTGGTGTGGCAGGG - Intronic
1161588114 19:5116589-5116611 CAAGACCCCCAGGGGTGTCATGG + Intronic
1162096925 19:8315777-8315799 GAACACCCACAGGTGTGGAGGGG + Intronic
1162278494 19:9676809-9676831 AAATACCCACAGGTGTGGAGGGG - Intergenic
1162281154 19:9699044-9699066 AAATACCCACGGGTGTGGAGGGG + Intronic
1162291460 19:9784079-9784101 AAATACCAACAGGTGTGGAGGGG - Intronic
1162292314 19:9789371-9789393 AAATACCCAGAGGTGTGGAGGGG - Intronic
1162668061 19:12231850-12231872 AAACACCCACAGGTGTGGAGGGG - Intronic
1163203170 19:15782610-15782632 AAATACCCACAGGGGTGGAGGGG - Intergenic
1163223099 19:15935608-15935630 CACTACCCACAGTTAGGGCAAGG - Intergenic
1163885659 19:19962547-19962569 AAACACCCACAGGTGTGGAGGGG + Intergenic
1163898892 19:20083266-20083288 AAATACTCACAGGTGTGGAGGGG + Intronic
1163906973 19:20156353-20156375 AAACACCCACAGGTGTGGAGGGG - Intergenic
1163920793 19:20286669-20286691 AAACACCCACAGGTGTGGAGGGG + Intergenic
1163937970 19:20467262-20467284 AAACACCCACAGGTGTGGAGGGG + Intergenic
1163986959 19:20962512-20962534 AAATACCCACAGGTGTGGAGGGG + Intergenic
1164049108 19:21568874-21568896 AAACACCCACAGGTGTGGAGGGG + Intergenic
1164055675 19:21620239-21620261 AAATACCCACAGGTGTGGAGGGG - Intergenic
1164122927 19:22284466-22284488 AAACACCCACAGGTGTGGAGGGG + Intergenic
1164154438 19:22581722-22581744 AAACACCCACAGGTGTGGAAGGG + Intergenic
1164208696 19:23078728-23078750 AAACACCCACAGGTGTGGAGGGG + Intronic
1164229785 19:23277041-23277063 AAATACCCACAGGTGTGGAGGGG - Intergenic
1164273364 19:23693549-23693571 AAACACCCACAGGTGTGGAGGGG + Intergenic
1164276533 19:23723673-23723695 TAACACCCACAGGTGTGGAGGGG - Intergenic
1164424797 19:28131561-28131583 AAACACCCACAGGTGTGGAGGGG + Intergenic
1164488946 19:28689327-28689349 AAACACCCACAGGTGTGGAGGGG - Intergenic
1164494687 19:28749336-28749358 GAATTCCCACATGTGTGGGAGGG - Intergenic
1165328870 19:35130312-35130334 AAATACCCACAGGTGTGGAGGGG + Intronic
1165523455 19:36332184-36332206 AAATACCCACAGGTGTGGAGGGG - Intergenic
1165595175 19:37007083-37007105 AAATACCCACAGGTGTGGAGGGG + Intergenic
1165607109 19:37115212-37115234 AAACACCCACAGGTGTGGAGGGG - Intronic
1165652262 19:37501758-37501780 AAATACCCACAGGTGTGGAGGGG - Intergenic
1165655625 19:37529824-37529846 AAACACCCACAGGTGTGGAGGGG - Intronic
1165666129 19:37629966-37629988 AAACACCCACAGGTGTGGAGGGG - Intronic
1165952126 19:39480404-39480426 AAACACCCACAGGTGTGGAGGGG + Exonic
1165977362 19:39688362-39688384 AAATACCCACAGGTGTGAAGGGG - Intergenic
1166144264 19:40823574-40823596 AAATACCCACAGGTGTGAAGGGG + Intronic
1166157145 19:40922217-40922239 AAATACCCACAGGTGTGGGGGGG - Intergenic
1166172120 19:41036060-41036082 AAATACCCACAGGTGTGGAGGGG - Intergenic
1166248109 19:41545570-41545592 AAATACCCACAGGTGTGGAGAGG + Intergenic
1166596295 19:44053123-44053145 AAACACCCACAGGTGTGGAGAGG - Intronic
1166653725 19:44595026-44595048 AAACACCCACAGGTGTGGAGGGG + Intergenic
1167004904 19:46769333-46769355 AAATACCCATAGGTGTGGAGGGG + Intronic
1167336840 19:48891618-48891640 AAATACCCACGGGTGTGGAGGGG - Intronic
1167814712 19:51869664-51869686 AAACACCCACAGGTGTGGACGGG + Intronic
1167819127 19:51909945-51909967 AAACACCCACAGGTGTGGAGGGG + Intronic
1167820353 19:51922102-51922124 AAATACCCACAGGTGTGGAGGGG + Intronic
1167820781 19:51925849-51925871 AAATACCCACAGGTGTGGAGAGG + Intronic
1167824368 19:51958741-51958763 AAACACCCACAGGTGTGGAGGGG + Intergenic
1167824515 19:51960256-51960278 AAATATCCACAGGGGTGGAAGGG - Intergenic
1167827119 19:51983911-51983933 AAATACCCACAGGTGTGGAGGGG + Intronic
1167867313 19:52338795-52338817 AAACACCCACAGGTGTGGAGGGG - Intronic
1167876834 19:52420971-52420993 AAACACCCACAGGTGTGGAGGGG - Intergenic
1167888258 19:52519608-52519630 AAATACTCACAGGTGTGGAGGGG - Intergenic
1167893267 19:52559624-52559646 AAATGCCCACAGGTGTGGAGGGG + Intronic
1167910433 19:52697755-52697777 AAACACCCACAGGTGTGGAGGGG - Intergenic
1167913684 19:52723574-52723596 AAATACTCACAGGTGTGGAGGGG - Intronic
1167915983 19:52740453-52740475 AAATATCCACAGGTGTGGAGTGG - Intergenic
1167916202 19:52741992-52742014 AAATACTCACAGGTGTGGAGGGG + Intergenic
1167921970 19:52789508-52789530 AAATGCCCACAGGTGTGGAGGGG + Intronic
1167928960 19:52848008-52848030 AAATACCCACAGGTATGGAGGGG + Intronic
1167931824 19:52872338-52872360 GAATACCCACAGGTGTGGAGGGG - Intronic
1167940836 19:52944595-52944617 AAATACCCACAGGTGTGTAGGGG - Intronic
1167951034 19:53027921-53027943 AAATACCCACAGGTGTGGAGGGG - Intergenic
1168002446 19:53459950-53459972 GAATACCCACAGATGTGGAGGGG - Intergenic
1168003665 19:53468348-53468370 AAATACCCACAGGTGTGGAAGGG - Intronic
1168007040 19:53498561-53498583 AAACACCCACAGGTGTGGAGGGG + Intergenic
1168052448 19:53839555-53839577 AAACACCCACAGGTGTGGAGGGG + Intergenic
1168218628 19:54944627-54944649 AAACACCCACAGGTGTGGAGGGG + Intronic
1168219494 19:54950299-54950321 AAATGCCCACAGGTGTGGAGGGG - Intronic
1168235510 19:55060652-55060674 AAATACCCACAGGTGTGGAGGGG + Intronic
1168358596 19:55718850-55718872 AAATACCCACAGGTGTGGAGGGG + Intronic
1168477325 19:56686028-56686050 AAATACCCACAGGTGTGGAGGGG - Intergenic
1168581274 19:57557665-57557687 AAATACCCACAGGTGTAGAGGGG + Intronic
1168612363 19:57811532-57811554 AAACACCCACAGGTGTGGAGAGG + Intronic
1168614191 19:57824558-57824580 AAATGCCCACAGGTGTGGAGGGG + Intronic
1168638364 19:58013560-58013582 AAATACCCACAGGTGTGGAGGGG - Intergenic
924967917 2:95018-95040 AAATACCCACAGGTGTGGAGGGG + Intergenic
925037580 2:702564-702586 AAATACCCACAGGTGTGGAGGGG - Intergenic
925142614 2:1560285-1560307 AAATACCCACAGGTGTGGAGGGG - Intergenic
925336777 2:3104493-3104515 AAACACCCACAGGTGTGGAGGGG - Intergenic
928539943 2:32275597-32275619 AAACACCCACAGGTGTGGAGGGG - Intergenic
929041799 2:37751543-37751565 GAATACCCACAGGTGTGGAGGGG + Intergenic
929208189 2:39322090-39322112 AAACACCCACAGGTGTGGAGGGG + Intronic
930786914 2:55280197-55280219 AAACACCCACAGGTGTGGAGGGG + Intergenic
931931570 2:67142822-67142844 AAATACTCACAGGTGGGACAAGG + Intergenic
932105424 2:68937089-68937111 CAATGCCTATAAGTGTGGCATGG + Intergenic
932600253 2:73119200-73119222 ATATACCCACAGGTGTGGAGGGG - Intronic
933838132 2:86262230-86262252 AAACACCCACAGGTGTGGAGAGG + Intronic
934123789 2:88866513-88866535 AAATACCCACAGGTGTGGAGGGG - Intergenic
934488940 2:94744678-94744700 AAACACCCACAGGTGTGGAGGGG - Intergenic
934543054 2:95192332-95192354 AAATACCCACAGGTGTGGAGGGG + Intergenic
934592466 2:95568147-95568169 AAATACCCACAGGTGTGGAGGGG + Intergenic
934864456 2:97793697-97793719 CAAAACCCACAGTTTTGGCTGGG + Intronic
935007138 2:99089792-99089814 GAAGACCCTCAGGTGGGGCAGGG - Intronic
935656235 2:105426019-105426041 AAATACCCACAGGTGTGGAGGGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936107411 2:109636853-109636875 AAATACCCACAGGTGTGGAGGGG - Intergenic
936988116 2:118331238-118331260 CAATACCCCCAGATGGGGAAGGG + Intergenic
937170073 2:119856878-119856900 CAATTCCTGCAGGTGTGGCATGG + Intronic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
938235446 2:129702348-129702370 AAATACCCACAGGTGTGGAGGGG + Intergenic
938270030 2:129961980-129962002 AAACACCCACAGGTGTGGAGGGG - Intergenic
939476596 2:142695104-142695126 AAATACTCACAGGTGTGGAGGGG - Intergenic
940358258 2:152769091-152769113 AAATACCCACAGGTGTGGAGGGG - Intergenic
941696853 2:168562266-168562288 AAATACCCACAGGTGTGGAGGGG - Intronic
941754410 2:169169240-169169262 AAATACCTACAGGTGTGGAGGGG + Intronic
941859397 2:170263319-170263341 AAACACCCACAGGTGTGGAGGGG - Intronic
942853159 2:180514658-180514680 CAAAATCCACAGCTATGGCAGGG + Intergenic
943327627 2:186521015-186521037 AAACACCCACAGGTGTGGAGGGG + Intergenic
943881006 2:193143350-193143372 AAACACCCACAGGTGTGGAGGGG + Intergenic
943977609 2:194504357-194504379 AAACACCCACAGGTGTGGAGGGG - Intergenic
944582069 2:201139930-201139952 AAAAACCCACAGGTGTGGAGGGG + Intronic
945832472 2:214803815-214803837 AAACACCCACAGGTGTGGAGGGG + Intronic
946204807 2:218096491-218096513 ATATACCCACAGGTGTGGAGGGG + Intergenic
946412448 2:219522114-219522136 CAACACCCACGGGTGTCCCAAGG - Intronic
946607404 2:221420848-221420870 CCATACCCTCTGGAGTGGCAAGG + Intronic
946780760 2:223191406-223191428 AAACACCCACAGGTGTGGAGGGG + Intronic
947212655 2:227722218-227722240 AAATACCCACAGGTGTGGAGAGG - Intergenic
947273329 2:228363657-228363679 AAACACCCACAGGTGTGGAGGGG - Intergenic
947520662 2:230843654-230843676 AAACACCCACAGGTGTGGAGGGG - Intergenic
947619168 2:231577706-231577728 AAACACCCACAGGTGTGGAGGGG + Intergenic
947730181 2:232423928-232423950 AAACACCCACAGGTGTGGAGGGG + Intergenic
947953472 2:234168080-234168102 AAACACCCACAGGTGTGGAGGGG - Intergenic
1168825659 20:811849-811871 AAATACCCACAGGTGTGAAGGGG - Intergenic
1169471052 20:5885960-5885982 ATATACCCACAGGTGTGGAGGGG + Intergenic
1169658940 20:7957130-7957152 AAACACCCACAGGTGTGGAGGGG + Intergenic
1170397778 20:15946679-15946701 AAATACCCACAGGTGTGGAGGGG - Intronic
1170468103 20:16641303-16641325 CAAAAACCAGAGGTGTGTCAGGG + Intergenic
1170967369 20:21085963-21085985 CAAGACCCACAGGGGTGACGTGG + Intergenic
1171272790 20:23829337-23829359 AAATACCCACAGGTGTGGAGGGG - Intergenic
1171276499 20:23860613-23860635 AAACACCCACAGGTGTGGGGGGG - Intergenic
1171450674 20:25233853-25233875 AAACACCCACAGGTGTGGAGGGG - Intergenic
1171451971 20:25242178-25242200 AAATACCCACAGGTGTGGAGGGG + Intergenic
1171495253 20:25550356-25550378 AAATACCCACAGGTGTGGAGGGG - Intronic
1171540546 20:25949907-25949929 GAATTCCCACATGTGTGGGAGGG + Intergenic
1171770093 20:29316297-29316319 AAATACCCACAAGTGTGGAGGGG - Intergenic
1171783241 20:29440318-29440340 AAACACCCACAGGTGTGGAGGGG - Intergenic
1171800530 20:29610424-29610446 GAATTCCCACATGTGTGGGAGGG - Intergenic
1171843575 20:30246282-30246304 GAATTCCCACATGTGTGGGAGGG + Intergenic
1172337381 20:34128496-34128518 AAATACCCACAGGTGTGCAGGGG + Intergenic
1172338514 20:34136543-34136565 AAATACCCACAGGTGTGGAGGGG + Intergenic
1172352232 20:34252125-34252147 AAATACCCACAGGTGTGGAGGGG - Intronic
1172374468 20:34425957-34425979 AAATACCCACAGGTATGGAGGGG + Intronic
1172479420 20:35262139-35262161 AAACACCCACAGGTGTGGAGGGG - Intronic
1172545036 20:35754114-35754136 CAATCCTCCCAGGTGTGGCTGGG + Intergenic
1172716577 20:36968773-36968795 AAATACCCACAGGTGTGGAGGGG + Intergenic
1174729944 20:52906255-52906277 CAATAGCCACAAGTGGTGCAGGG + Intergenic
1176163343 20:63659703-63659725 AAATACCCACAGGTGTGGAGGGG - Intronic
1176294803 21:5065739-5065761 CAACACCCACAGCCGTGACACGG - Intergenic
1176424352 21:6538830-6538852 AAACACCCACAGGTGTGGAGGGG - Intergenic
1176766568 21:13024702-13024724 AAGTACCCACAGGTGTGGAGGGG + Intergenic
1176838837 21:13820811-13820833 AAACACCCACAGGTGTGGAGGGG + Intergenic
1177175069 21:17694231-17694253 AAACACCCACAGGTGTGGAGGGG - Intergenic
1177198992 21:17932734-17932756 AAACACCCACAGGTGTGGAGGGG - Intronic
1177265264 21:18775077-18775099 CAGGACCCACAGGTGTGAAAAGG + Intergenic
1177290462 21:19104291-19104313 AAATACCCATAGGTGTGGAGGGG + Intergenic
1177367461 21:20156088-20156110 TAATCCCCACAAGTATGGCAAGG + Intergenic
1178483087 21:32997252-32997274 AAATACCCACAGGTGTGGAGGGG + Intergenic
1178831694 21:36061821-36061843 AAACACCCACAGGTGTGGAGCGG - Intronic
1179123830 21:38573845-38573867 AAATACCCACAGTTGTGGAGGGG + Intronic
1179444375 21:41420884-41420906 AAACACCCACAGGTGTGGAGGGG - Intronic
1179699845 21:43147145-43147167 AAACACCCACAGGTGTGGAGGGG - Intergenic
1179878382 21:44282875-44282897 AAACACCCACAGGTGTGGAGGGG - Intergenic
1180333104 22:11550589-11550611 AAACACCCACAGGTGTGGAGGGG + Intergenic
1180431134 22:15251249-15251271 AAATACCCACAGATGTGGAGGGG + Intergenic
1180513694 22:16119150-16119172 AAGTACCCACAGGTGTGGAGGGG + Intergenic
1180779999 22:18514857-18514879 AAACACCCACAGGTGTGGAGGGG + Intergenic
1180812715 22:18772178-18772200 AAACACCCACAGGTGTGGAGGGG + Intergenic
1181184658 22:21094294-21094316 AAATACCCACAGGTGTGGAGGGG + Intergenic
1181198873 22:21206426-21206448 AAACACCCACAGGTGTGGAGGGG + Intergenic
1181535246 22:23538694-23538716 AAATACCCACAGGTGTGGAGGGG + Intergenic
1181536372 22:23548393-23548415 AAATACCCACAGGTGTGGAGGGG + Intergenic
1181594918 22:23908012-23908034 AAACACCCACAGGTGTGGAGGGG + Intergenic
1181837281 22:25621192-25621214 CAATTCCCACAAGTGTGGTGTGG + Intronic
1182166434 22:28178953-28178975 CAATCCCCACAGATGGGGAATGG + Intronic
1182713497 22:32337053-32337075 AAAGACCCAGATGTGTGGCACGG + Intergenic
1183145967 22:35992137-35992159 CAACATCCGCTGGTGTGGCAAGG - Intronic
1203227932 22_KI270731v1_random:88411-88433 AAACACCCACAGGTGTGGAGGGG - Intergenic
1203294016 22_KI270736v1_random:23063-23085 GAATACCCACAGGTGTGGAAGGG + Intergenic
949547102 3:5081642-5081664 AAACACCCACAGGTGTGGAGGGG - Intergenic
949804754 3:7942660-7942682 AAATACCCACAGATGTGGAGGGG + Intergenic
950031016 3:9853650-9853672 AAACACCCACAGGTGTGGAGGGG - Intronic
950387995 3:12675045-12675067 AAACACCCACAGGTGTGGAGGGG + Intergenic
950704638 3:14772279-14772301 CACTACCCCCAGGCGTGGCCTGG + Intronic
950752981 3:15145544-15145566 AAATACCCACAGGTGTGGAGGGG - Intergenic
951514572 3:23544678-23544700 AAACACCCACAGGTGTGGAGGGG - Intronic
951886760 3:27532232-27532254 ATATACCCACAGGTGTGGAGGGG + Intergenic
952905179 3:38135250-38135272 AAATACCCACAGGTGTGGAGGGG - Intronic
952905339 3:38136440-38136462 AAATACCCACAGGTGTGAAGGGG + Intronic
953345962 3:42175761-42175783 CAATTCCCAAATGTGTCGCATGG + Intronic
953428087 3:42812152-42812174 GAATACCCAGAGGTGTGGAGGGG + Intronic
953481795 3:43258320-43258342 AAACACCCACAGGTGTGGAGGGG - Intergenic
954440747 3:50520811-50520833 AAACACCCACAGGTGTGGAGGGG + Intergenic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
955257188 3:57344176-57344198 AAATACCCACAGGTGTGGAGGGG + Intronic
956168220 3:66412515-66412537 AAATACCCTCAGGTTTGGCCCGG + Intronic
957045877 3:75374178-75374200 AAATACCCACAGGTGTGGAGGGG - Intergenic
957067621 3:75538710-75538732 AAATACCCACAGGTGTGGAGGGG + Intergenic
957069059 3:75551345-75551367 AAATACCCACAGGGGTGGAGGGG + Intergenic
957069962 3:75559962-75559984 AAATACCCACAGGTATGGAGGGG + Intergenic
957074701 3:75592687-75592709 AAATACCCACAGGTGTGGAGGGG - Intergenic
957082237 3:75646254-75646276 AAACACCCACAGGTGTGGAGGGG + Intergenic
958065795 3:88543857-88543879 GAATTCCCACATGTGTGGGAGGG + Intergenic
958761614 3:98316148-98316170 AAATACCCACAGGTGTGGAGGGG - Intergenic
958765501 3:98362570-98362592 AAATACCCACAGGTGTGGAGGGG - Intergenic
958768411 3:98397483-98397505 CAATACCCAATGGTGTGCAAAGG - Intergenic
958819104 3:98952331-98952353 AAATACCATCAGGTGGGGCAGGG + Intergenic
958858811 3:99420249-99420271 AAAGACCCACAGGTGTGGAGGGG + Intergenic
958937468 3:100272509-100272531 AAACACCCACAGGTGTGGAGGGG - Intronic
958943168 3:100336341-100336363 AAACACCCACAGGTGTGGAGGGG - Intronic
958975693 3:100666156-100666178 AAACACCCACAGGTGTGGAGGGG - Intronic
959069948 3:101692824-101692846 AAACACCCACAGGTGTGGAGGGG + Intergenic
959071222 3:101703848-101703870 AAACACCCACAGGTGTGGAGGGG - Intergenic
959791566 3:110368013-110368035 AAACACCCACAGGTGTGGAGGGG + Intergenic
959948496 3:112152022-112152044 AAATACCCACAGGTGTGGAGGGG - Intronic
959981151 3:112519046-112519068 TAATTCCCACATGTGTGGGAGGG + Intergenic
960809055 3:121611119-121611141 AAATACCCACAGGTGTGGAGGGG - Intronic
961276506 3:125731431-125731453 AAATACCCACAGGTGTGGAGGGG + Intergenic
961279397 3:125754024-125754046 AAATACCCACAGGTGTGGAGAGG + Intergenic
961285528 3:125799266-125799288 AAATACCCACAGGTGTGGAGCGG - Intergenic
961296801 3:125891225-125891247 GAACACCCACAGGTGTGGAGGGG + Intergenic
961297615 3:125899559-125899581 GAACACCCACAGGTGTGGAAAGG + Intergenic
961512512 3:127411668-127411690 AAACACCCACAGGTGTGGAGGGG - Intergenic
961833972 3:129641267-129641289 AAACACCCACAGGTGTGGAGGGG - Intergenic
961877929 3:130038302-130038324 AAATACCCACAGGTGTGGAGGGG - Intergenic
961890069 3:130123355-130123377 AAATACCCACAAGTGTGGAGGGG - Intergenic
962128707 3:132649757-132649779 AAATACCCACAGGTGTGGAGGGG + Intronic
962334589 3:134515954-134515976 AAACACCCACAGGTGTGGAGGGG - Intronic
962675074 3:137750211-137750233 CAACAGCCACAGGAGTGGCTTGG + Intergenic
963216241 3:142752060-142752082 AAATACCCACAGGTGTGGAGGGG - Intronic
963468123 3:145709264-145709286 AAACACCCACAGGTGTGGAGGGG - Intergenic
964909139 3:161756629-161756651 CACTACCCAGAGGTGTTGTAGGG + Intergenic
965901495 3:173645936-173645958 CAATGCCCATGAGTGTGGCAGGG - Intronic
966073275 3:175905565-175905587 AAACACCCACAGGTGTGGAGGGG - Intergenic
966377970 3:179316591-179316613 AAATGCCCACAGGTGTGGAGGGG - Intergenic
966733647 3:183170970-183170992 AAATACCCACAGGTGTGGAGGGG + Intergenic
966761495 3:183423215-183423237 CAGTACCAACAGCTGAGGCATGG + Intronic
966771824 3:183510937-183510959 AAATACCCACAGGTGTAGAGGGG - Intronic
967179020 3:186886889-186886911 AAACACCCACAGGTGTGGAGGGG - Intergenic
967179814 3:186894149-186894171 AAACACCCACAGGTGTGGAGGGG + Intergenic
967418823 3:189251386-189251408 AAACACCCACAGGTGTGGAGGGG - Intronic
968061325 3:195728114-195728136 AAATACCCACAGGTGTGGAGGGG - Intronic
968221755 3:196944991-196945013 AAACACCCACAGGTGTGGAGGGG + Intergenic
968224210 3:196963015-196963037 AAATACCCACAGGTGTGGAGGGG + Intronic
968375814 4:40554-40576 AAACACCCACAGGTGTGGAGGGG - Intergenic
968392958 4:207815-207837 AAACACCCACAGGTGTGGAGGGG - Intergenic
968396349 4:242164-242186 AAATACCCACAGGTGTGGAGGGG + Intergenic
968695307 4:2022307-2022329 AAATACCCACAGGTGTGAAGGGG + Intronic
969000542 4:3977339-3977361 AAATACCCACAGGGGTGGAGGGG - Intergenic
969001466 4:3985925-3985947 AAATACCCACAGGTGTGGAGGGG - Intergenic
969012199 4:4075276-4075298 AAATACCCACAGGTGTGGAGGGG + Intergenic
969018310 4:4120324-4120346 AAATACCCACAGGTGTGGAGGGG - Intergenic
969741885 4:9034432-9034454 AAATACCCACAGGTGTGGAGGGG - Intergenic
969752555 4:9122772-9122794 AAATACCCACAGGTGTGGAGGGG + Intergenic
969753472 4:9131330-9131352 AAATACCCACAGGTGTGGAGGGG + Intergenic
969760369 4:9176798-9176820 AAACACCCACAGGTGTGGAGGGG - Intergenic
969786986 4:9466183-9466205 AAATACCCACAGGTGTGGAGGGG + Intergenic
969794887 4:9519849-9519871 AAATACCCACAAGTGTGGAGCGG + Intergenic
969801256 4:9567329-9567351 AAATACCCACAGGTGTGGAAGGG - Intergenic
969812452 4:9658936-9658958 AAATACCCACAGGTGTGGAGGGG + Intergenic
969813375 4:9667513-9667535 AAATACCCACAGGGGTGGAGGGG + Intergenic
969822591 4:9731789-9731811 AAACACCCACAGGTGTGGAGGGG - Intergenic
969825168 4:9752028-9752050 AAATACCCACAGGTGTGGAGGGG + Intergenic
970018985 4:11545657-11545679 AGAGACCCAGAGGTGTGGCAGGG - Intergenic
970440523 4:16077595-16077617 AAACACCCACAGGTGTGGAGGGG + Intronic
970573645 4:17406679-17406701 CAATACCCACCTCTGTGGCTGGG - Intergenic
971719996 4:30232918-30232940 AAATACCCACAGGTGTGGAGGGG - Intergenic
972846857 4:43001650-43001672 AAATACCCGCAGGTGTGGAGGGG - Intronic
973343511 4:49030062-49030084 AAATACCCACAGGTGTGGAGGGG + Intronic
974518041 4:62941808-62941830 AAACACCCACAGGTGTGGAGGGG + Intergenic
974621214 4:64356833-64356855 AATTACCCACAGGTGTGGAGGGG + Intronic
974960587 4:68694396-68694418 AAACACCCACAGGTGTGGAGGGG + Intergenic
975200478 4:71582459-71582481 CAATTCCCACATGTGTGGGAGGG + Intergenic
975519622 4:75286611-75286633 ATATACCCACAGGTGTGGAGGGG - Intergenic
976680113 4:87746325-87746347 AAATACCCACAGGTGTGGAGCGG - Intergenic
978048997 4:104171957-104171979 AAATACCCACAGGTGTGGAGGGG + Intergenic
979141732 4:117184043-117184065 AAACACCCACAGGTGTGGAGGGG + Intergenic
979327553 4:119397295-119397317 AAACACCCACAGGTGTGGAGGGG + Intergenic
979996641 4:127439492-127439514 AAATACCCACAGGTGTGGAGGGG - Intergenic
982512770 4:156304777-156304799 AAACACCCACAGGTGTGGAAGGG - Intergenic
982518717 4:156386369-156386391 AAATACCCACAGGTGTGGAGGGG - Intergenic
982799996 4:159693882-159693904 CAAAACTAACAGGTGTGACATGG - Intergenic
982823709 4:159976503-159976525 AAACACCCACAGGTGTGGAGGGG - Intergenic
983001455 4:162419435-162419457 ATATACCCACAGGTGTGGAGGGG + Intergenic
983205375 4:164905529-164905551 AAACACCCACAGGTGTGGAGGGG - Intergenic
983212831 4:164976345-164976367 AAATACCCACAGGTGTGGAGGGG + Intronic
983214576 4:164991313-164991335 TAACACCCACAGGTGTGGAGGGG + Intergenic
983215257 4:164996618-164996640 AAACACCCACAGGTGTGGAGGGG + Intergenic
983215981 4:165002879-165002901 AAACACCCACAGGTGTGGAGGGG + Intergenic
983224597 4:165074087-165074109 AAATACCCACAGGTGTGGAGGGG + Intergenic
983313199 4:166093078-166093100 AAATACCCACAGGTGTGGAGAGG - Intronic
984423361 4:179553187-179553209 AAACACCCACAGGTGTGGAGGGG - Intergenic
985494501 5:196799-196821 AAATACCCACAGGTGTGGAGGGG - Intergenic
985734092 5:1567405-1567427 AAATACCCACAGGTGTGGAGGGG - Intergenic
985738001 5:1595992-1596014 AAACACCCACAGGTGTGGAGGGG - Intergenic
986549706 5:8938671-8938693 AAACACCCACAGGTGTGGAGGGG + Intergenic
987490934 5:18579385-18579407 AAACACCCACAGGTGTGGAGGGG + Intergenic
987936116 5:24466741-24466763 AAATACCCACAGGTGTGGAGGGG + Intergenic
988062222 5:26186000-26186022 AAATACCCACAGTTGTGGAGGGG - Intergenic
988063072 5:26198387-26198409 AAATACCCACAGGTGTGGAGGGG + Intergenic
988379909 5:30486668-30486690 AAACACCCACAGGTGTGGAGGGG - Intergenic
988380833 5:30495163-30495185 AAACACCCACAGGTGTGGAGGGG - Intergenic
988850683 5:35177316-35177338 AAACACCCACAGGTGTGGAGGGG + Intronic
989085586 5:37672853-37672875 AAATACCCACAGGTGTGGAGGGG + Intronic
989296049 5:39828069-39828091 AAATACCCACAGGTGTGGAGGGG - Intergenic
989583881 5:43059076-43059098 AAATACCCACAGGTGTGGAGGGG + Intergenic
989586381 5:43077035-43077057 AAATACCCACAGGTGTGGAGAGG - Intronic
989640832 5:43581352-43581374 AAACACCCACAGGTGTGGAGGGG + Intergenic
989737841 5:44730502-44730524 AAACACCCACAGGTGTGGAGGGG - Intergenic
990414371 5:55572002-55572024 AAACACCCACAGGTGTGGAGGGG + Intergenic
990619818 5:57547627-57547649 AAATACCCACAGGTGTGGAGGGG + Intergenic
990789827 5:59464717-59464739 AAACACCCACAGGTGTGGAGGGG + Intronic
992459398 5:76945913-76945935 AAATACCCACAGGTGTGGAGGGG + Intergenic
992597509 5:78360888-78360910 CAAAACCCAAAGGAGTGACACGG - Intronic
992656035 5:78910328-78910350 AAATACCCACAGGTGTGGAGGGG + Intronic
992779163 5:80112616-80112638 AAATACCCACAGGTGTGGAGGGG + Intronic
993258445 5:85624199-85624221 CAATGCCAACAGGGGTGGGAGGG - Intergenic
993698352 5:91089078-91089100 CAATACCCACAGGTGTGGCAGGG - Intronic
993889664 5:93458076-93458098 AAATGCCCACAGGTGTGGAGGGG - Intergenic
994091313 5:95811964-95811986 AAATACCCACAGGTGTAGAGGGG + Intronic
994404667 5:99329380-99329402 AAATACCCACAGGTGTGGAGGGG + Intergenic
994503277 5:100607011-100607033 AAATACCCACAGGTGTGGAGGGG + Intergenic
994531924 5:100983064-100983086 AAACACCCACAGGTGTGGAGGGG - Intergenic
994534078 5:101006205-101006227 AAATACCCACAGGTGTGGAGGGG - Intergenic
994804620 5:104428349-104428371 AAATACCCACAGCTGTGACCAGG - Intergenic
995527212 5:113059630-113059652 CAAGACACACATGTGTGGCGAGG - Intronic
995740142 5:115347531-115347553 AAATATCCACAGGTGTGGAGGGG + Intergenic
995750546 5:115449338-115449360 AAATACCCACAGGTATGGAAGGG + Intergenic
995878934 5:116822061-116822083 AAACACCCACAGGTGTGGAGGGG + Intergenic
997115975 5:131126179-131126201 CAATTCCCACGTGTGTGGAAGGG + Intergenic
997124467 5:131212073-131212095 AAATCACCACATGTGTGGCAGGG + Intergenic
999295009 5:150453776-150453798 AAACACCCACAGGTGTGGAGGGG - Intergenic
999361565 5:150990493-150990515 AAATACCCACAGGTGTGGAGGGG - Intergenic
999419171 5:151426168-151426190 AAACACCCACAGGTGTGGAGGGG - Intergenic
999560586 5:152797305-152797327 AAATACCCACAGGTGTGGAGGGG - Intergenic
999752963 5:154643663-154643685 ATATACCCACAGGTGTGGAGGGG - Intergenic
999989208 5:157034015-157034037 AAATACCCACAGGTGTGGAGGGG - Intronic
1000064898 5:157685971-157685993 AAATACCTACAGGTGTGGAGGGG - Intergenic
1000527093 5:162371087-162371109 AAATATCCACAGGTGTGGAGGGG + Intergenic
1001232026 5:169996890-169996912 AAACACCCACAGGTGTGGAGGGG - Intronic
1002666323 5:180828195-180828217 AAACACCCACAGGTGTGGAGGGG + Intergenic
1003008697 6:2405987-2406009 GAATTCCCACATGTGTGGGAGGG - Intergenic
1003066670 6:2909593-2909615 AAACACCCACAGGTGTGGAGGGG + Intergenic
1003374606 6:5564195-5564217 CAATTCCCACAAGTGTGGTGTGG + Intronic
1003893398 6:10583947-10583969 AAATACCCACAGGAGTGGAGAGG - Intronic
1004620879 6:17329261-17329283 AAATAACCACAGGTCGGGCATGG - Intergenic
1004717036 6:18227659-18227681 AAACACCCACAGGTGTGGAGGGG + Intronic
1005293322 6:24400062-24400084 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1005321790 6:24662756-24662778 AAATACCCACAGGTGTGGAGGGG + Intronic
1005430183 6:25748498-25748520 ATATACCCACAGGTGTGGAGGGG - Intergenic
1005525391 6:26642466-26642488 AAATACCCACAGGTGTGGAGGGG + Intronic
1005618337 6:27596736-27596758 ATATACCCACAGGTGTGGAGGGG - Intergenic
1005638668 6:27774475-27774497 AAACACCCACAGGTGTGGAGGGG - Intergenic
1005730084 6:28688319-28688341 AAACACCCACAGGTGTGGAGGGG + Intergenic
1006238487 6:32657141-32657163 AAACACCCACAGGTGTGGAGGGG - Intergenic
1006250332 6:32778083-32778105 AAACACCCACAGGTGTGGAGGGG - Intergenic
1006289257 6:33121951-33121973 AAATACCCACAGGTGTGGAGGGG - Intergenic
1006386008 6:33731285-33731307 CCATAGCCTCACGTGTGGCAGGG - Intronic
1006399701 6:33809975-33809997 AAACACCCACAGGTGTGGAGGGG - Intergenic
1006538380 6:34719475-34719497 AAACACCCACAGGTGTGGAGGGG - Intergenic
1006864104 6:37194524-37194546 CAATACTCACAGCTGTGGGTAGG - Intergenic
1007571391 6:42893686-42893708 AAATACCCGCAGGTGTGGAGGGG - Intergenic
1007572411 6:42902648-42902670 AGATACCCACAGGTGTGGAGGGG - Intergenic
1007624836 6:43239506-43239528 AAATACCCACAGGTGTGGAGGGG - Intergenic
1007793450 6:44328063-44328085 AAACACCCACAGGTGTGGAGGGG - Intronic
1008563830 6:52748294-52748316 AAATACCCACAGCTGTGGAGGGG - Intergenic
1008565375 6:52762761-52762783 AAACACCCACAGGTGTGGAGGGG + Intronic
1008583066 6:52923603-52923625 AAACACCCACAGGTGTGGAGGGG + Intergenic
1008585791 6:52947713-52947735 AAATACCCACAGGTGTGGAGGGG - Intergenic
1009193379 6:60655975-60655997 AAATACCCACAGGTGTGGAGGGG + Intergenic
1009193791 6:60660938-60660960 AAATACCCACAGGTGTGGAGGGG + Intergenic
1010423787 6:75704094-75704116 ACATACCTACAGGTGTGGAAGGG - Intronic
1010839809 6:80635633-80635655 AAATACCCACAGGTGTGGAGGGG + Intergenic
1011693558 6:89891728-89891750 AAACACCCACAGGTGTGGAGGGG + Intergenic
1011967253 6:93174293-93174315 AAACACCCACAGGTGTGGAGGGG + Intergenic
1012120523 6:95361229-95361251 AAATACCCACAGGTGTGGAGGGG - Intergenic
1012458222 6:99430290-99430312 AAACACCCACAGGTGTGGAGGGG + Intergenic
1012753722 6:103196194-103196216 AAATGCCCACAGGAGTGGTATGG + Intergenic
1013555710 6:111255112-111255134 AAACACCCACAGGTGTGGAGGGG - Intergenic
1014396719 6:120932376-120932398 AAACACCCACAGGTGTGGAGGGG + Intergenic
1014800753 6:125775862-125775884 AAACACCCACAGGTGTGGAGGGG - Intergenic
1015285305 6:131479609-131479631 AAATACCCACAGGTGTGGAGGGG + Intergenic
1015574703 6:134659125-134659147 AAACACCCACAGGTGTGGAGGGG - Intergenic
1015878200 6:137845304-137845326 AAACACCCACAGGTGTGGAGGGG + Intergenic
1016177258 6:141096224-141096246 AAATACCCACAGGTGTGGAAGGG - Intergenic
1017062735 6:150500622-150500644 GAATTCCCACAAGTGTGGGAGGG + Intergenic
1017102646 6:150862403-150862425 AAATACCCACAGGTGTGGAGGGG + Intergenic
1017171036 6:151455225-151455247 AAACACCCACAGGTGTGGAGGGG - Intronic
1017636359 6:156447449-156447471 CAAAGCCAACAGGTGGGGCAAGG + Intergenic
1018060029 6:160082926-160082948 AAATACCCACAAGTGTGGAGGGG - Intronic
1018597748 6:165501209-165501231 AAACACCCACAGGTGTGGAGGGG + Intronic
1018718344 6:166552904-166552926 CAATGGCCACAGGTGTGCAATGG + Intronic
1019071163 6:169346300-169346322 AAACACCCACAGGTGTGGAGGGG - Intergenic
1019687458 7:2389422-2389444 AAACACCCACAGGTGTGGAGGGG - Intergenic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1020329301 7:7001792-7001814 AAACACCCACAGGTGTGGAGGGG - Intergenic
1020370678 7:7428892-7428914 CAATAACCACTGATGTTGCAGGG + Intronic
1020676295 7:11188847-11188869 CAATATCAAGAGGTTTGGCATGG - Intergenic
1021680840 7:23129595-23129617 CAATACCCACAGTTTGGGGACGG - Intronic
1022164229 7:27741675-27741697 AAACACCCACAGGTGTGGAGGGG - Intronic
1022477115 7:30718599-30718621 ATATACCCACAGGTGTGGAGGGG - Intronic
1022677513 7:32513621-32513643 AAATACCCACAGGTGTGGAGGGG - Intronic
1023248272 7:38230859-38230881 AAATACCCACAGGTGTGGAGGGG - Intergenic
1023248900 7:38236652-38236674 CAGTGCCCACAGGTGTGCAATGG - Intergenic
1023669496 7:42560930-42560952 TAATTCCCACATGTGTGGGAGGG + Intergenic
1024291977 7:47811591-47811613 CAATCTTCACATGTGTGGCAAGG - Intronic
1024932144 7:54675216-54675238 AAACACCCACAGGTGTGGAGGGG - Intergenic
1025574609 7:62620174-62620196 AAATACCCACAAGTGTGGAGGGG + Intergenic
1025850891 7:65243049-65243071 AAACACCCACAGGTGTGGAGGGG - Intergenic
1025932196 7:66004699-66004721 AAATACTCACAGGTGTGGAGGGG - Intergenic
1026008581 7:66618970-66618992 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1026162461 7:67881546-67881568 AAATACCCACAGGTGTAGAGGGG - Intergenic
1026188582 7:68103768-68103790 AAATACCCACAGGTGTGGAGGGG - Intergenic
1026855312 7:73749705-73749727 AAATACCCACAGGTGTGGAGGGG - Intergenic
1028844794 7:95467722-95467744 CACTGCCCACAGGTGGGGCTAGG - Intergenic
1029076792 7:97941032-97941054 AAATACCCACAGGTGTGGAGGGG - Intergenic
1029790642 7:102839471-102839493 AAATACCCACAGGTGTGGAGGGG + Intronic
1029966799 7:104748851-104748873 AAACACCCACAGGTGTGGAGGGG + Intronic
1030009242 7:105149628-105149650 AAATACCCACAGGTGTGGAGGGG + Intronic
1030255408 7:107505256-107505278 CAATACCCAATGGTGGGGAAAGG + Intronic
1030630596 7:111891598-111891620 AAATACCAACATGTGTGGGATGG + Intronic
1031779178 7:125940657-125940679 AAATACCCACAGGTGTGGAGAGG + Intergenic
1031795503 7:126169090-126169112 AAACACCCACAGGTGTGGAGGGG + Intergenic
1033212205 7:139468336-139468358 AAAGACCCACAGGTGTGGAGGGG + Intronic
1033382350 7:140834675-140834697 AAAATCCCACAGATGTGGCACGG - Exonic
1033715344 7:143996141-143996163 ATATACCCACAGGTGTGGAGGGG - Intergenic
1034919549 7:155068818-155068840 CAATACAGACAGCTGTGGCCTGG + Exonic
1035518095 8:253745-253767 ATATACCCACAGGTGTGGAGGGG + Intergenic
1036240985 8:7080910-7080932 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036247079 8:7127002-7127024 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036253714 8:7187367-7187389 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036263993 8:7260544-7260566 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036265289 8:7268166-7268188 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036266590 8:7275788-7275810 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036267896 8:7283410-7283432 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036269200 8:7291032-7291054 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036270478 8:7298652-7298674 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036297395 8:7548403-7548425 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036298696 8:7556048-7556070 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036300001 8:7563698-7563720 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036301306 8:7571343-7571365 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036302605 8:7578992-7579014 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036313113 8:7699213-7699235 AAATACCCACAGCTGTGGAGGGG - Intergenic
1036316033 8:7719083-7719105 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036317341 8:7726731-7726753 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036318649 8:7734379-7734401 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036319956 8:7742026-7742048 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036321265 8:7749674-7749696 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036322574 8:7757322-7757344 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036323880 8:7764970-7764992 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036325183 8:7772618-7772640 AAACACCCACAGGTGTGGAGGGG - Intergenic
1036350872 8:8011692-8011714 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036352160 8:8019336-8019358 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036363778 8:8100113-8100135 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036375767 8:8198166-8198188 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036376689 8:8206662-8206684 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036831970 8:12027629-12027651 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036846146 8:12172109-12172131 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036852848 8:12216476-12216498 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036853763 8:12224977-12224999 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036867512 8:12414428-12414450 AAACACCCACAGGTGTGGAGGGG + Intergenic
1036874221 8:12458998-12459020 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036875138 8:12467487-12467509 AAATACCCACAGGTGTGGAGGGG - Intergenic
1036887181 8:12566966-12566988 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036894777 8:12625067-12625089 AAATACCCACAGGTGTGGAGGGG + Intergenic
1036902187 8:12678423-12678445 AAATACCCATAGGTGTGGAGGGG - Intergenic
1038921827 8:32093264-32093286 AAACACCCACAGGTGTGGAGGGG + Intronic
1039457052 8:37714323-37714345 CAACTCCTACAGCTGTGGCATGG + Intergenic
1040027546 8:42795709-42795731 AAACACCCACAGGTGTGGAGGGG - Intronic
1040339095 8:46430991-46431013 AAATACCCACAGGTGTGGAGGGG - Intergenic
1040340868 8:46439934-46439956 AAATACCCACAGGTGTGGAGGGG - Intergenic
1040413224 8:47176048-47176070 AAACACCCACAGGTGTGGAGGGG - Intergenic
1041371799 8:57169337-57169359 CAATACCCACATGTTTAACATGG - Intergenic
1041374469 8:57199618-57199640 AAACACCCACAGCTGTGGAAGGG - Intergenic
1041512979 8:58671754-58671776 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1042204315 8:66313071-66313093 AAATACCCACAGGTGTGGAGGGG - Intergenic
1044310386 8:90685809-90685831 AAACACCCACAGGTGTGGAGGGG + Intronic
1045593743 8:103628979-103629001 CAATTCCCACAGGTATGGAGAGG - Intronic
1046939623 8:119918223-119918245 AAAAACCCACAGGTGTGGAGGGG + Intronic
1047294878 8:123561915-123561937 CAATACCAACAGGGGTTGCCAGG + Intergenic
1049458622 8:142709473-142709495 AAACAGCCACAGGTGTGGCAGGG - Intergenic
1049482011 8:142829767-142829789 AAACACCCACAGGTGTGGAGGGG + Intergenic
1049501315 8:142968693-142968715 AAATACCCACAGGTGTGGAGGGG - Intergenic
1049506338 8:143001722-143001744 AAATGCCCACAGGTGTGGAGGGG + Intergenic
1049516106 8:143057621-143057643 CAATGCCCACAGTTTTGGGAGGG + Intronic
1049517298 8:143067476-143067498 AAATACTCACAGGTGTGGAGGGG - Intergenic
1049556938 8:143287305-143287327 AAACACCCACAGGTGTGGAGGGG - Intergenic
1049663711 8:143832920-143832942 AAACACCCACAGGTGTGGAGGGG + Intergenic
1049667034 8:143849724-143849746 AAACACCCACAGGTGTGGAGGGG - Intergenic
1049725969 8:144146677-144146699 AAATACCCACAGGTGTGGAGGGG + Intergenic
1049777038 8:144411224-144411246 AAATACTCACAGGTGTGGAGGGG + Intronic
1049845103 8:144796824-144796846 AAACACCCACAGGTGTGGAGGGG + Intergenic
1049876013 8:145021259-145021281 AAATACCCACAGGTGTGGAGGGG - Intergenic
1049876692 8:145027839-145027861 AAATACTCACAGGTGTGGAGGGG - Intergenic
1050385153 9:5082049-5082071 AATTACCCACAGGTGTGGAGGGG - Intronic
1050972436 9:11894535-11894557 AAACACCCACAGGTGTGGAGGGG - Intergenic
1051219785 9:14836183-14836205 CAATTCCCACAAGTGTGGTGTGG - Intronic
1051471364 9:17446291-17446313 AAACACCCACAGGTGTGGAGGGG + Intronic
1051920254 9:22256750-22256772 AAATACTCACAGGTGTGCCTAGG + Intergenic
1052279290 9:26715165-26715187 AAACACCCACAGGTGTGGAGGGG - Intergenic
1052469945 9:28881177-28881199 AAATACCCACAGGTGTGGAGGGG + Intergenic
1052676500 9:31632894-31632916 AAACACCCACAGGTGTGGAGGGG - Intergenic
1052799139 9:32951282-32951304 AAATACCCACACGTGTGGAGGGG + Intergenic
1053668848 9:40339671-40339693 AAAAACCCACAGGTGTGGAGGGG + Intergenic
1053736465 9:41106155-41106177 AAATACTCACAGGTGTGGAGGGG + Intergenic
1053918646 9:42965944-42965966 AAACACCCACAGGTGTGGAGGGG + Intergenic
1054379985 9:64479707-64479729 AAACACCCACAGGTGTGGAGGGG + Intergenic
1054418453 9:64902301-64902323 AAGTACCCACAGGTGTGGAGGGG - Intergenic
1054515763 9:66036623-66036645 AAACACCCACAGGTGTGGAGGGG - Intergenic
1054691906 9:68325245-68325267 AAATACTCACAGGTGTGGAGGGG - Intergenic
1054773854 9:69108151-69108173 CAATGCCCACAGTTTTGGGAGGG + Intergenic
1055157872 9:73087222-73087244 AAACACCCACAGGTGTGGAGGGG - Intergenic
1056211269 9:84367457-84367479 AAACACCCACAGGTGTGGAGGGG - Intergenic
1056826993 9:89883462-89883484 AAACACCCACAGATGTGGGAAGG + Intergenic
1056859544 9:90167234-90167256 AAATACCCACAGGTGCGGAGGGG + Intergenic
1056900700 9:90596879-90596901 CAAAACACACAGTTGTGTCAGGG + Intergenic
1057685786 9:97233070-97233092 AAACACCCACAGGTGTGGAGGGG + Intergenic
1057880775 9:98791270-98791292 CCATGCCAAGAGGTGTGGCAAGG + Intronic
1058806332 9:108595535-108595557 AAACACCCACAGGTGTGGAGGGG + Intergenic
1059143495 9:111876232-111876254 AAACACCCACAGGTGTGGAGGGG + Intergenic
1059309620 9:113379075-113379097 AAATACCCACAGGTGTGGAGGGG - Intergenic
1060309654 9:122447942-122447964 AAATACCCACAGGTGTGCAGGGG - Intergenic
1060831131 9:126717490-126717512 AAATACCCACAGGTGTGGAGGGG + Intergenic
1060931543 9:127492337-127492359 CCCTGCCCACAAGTGTGGCAGGG + Intronic
1061955360 9:133958704-133958726 AAACACCCACAGGTGTGGAGGGG + Intronic
1061979428 9:134092451-134092473 AAACACCCACAGGTGTGGAGGGG - Intergenic
1062098446 9:134714947-134714969 AAACACCCACAGGTGTGGTGGGG - Intronic
1062486670 9:136780327-136780349 AAATACCCGCAGGTGTGGAGGGG - Intergenic
1062487734 9:136788811-136788833 AAATACCCACAGGTGTGGAGGGG - Intergenic
1062489396 9:136797782-136797804 AAATACCCGCAGGTGTGGAGGGG + Intronic
1062556908 9:137117192-137117214 AAACACCCACAGGTGTGGAGGGG + Intergenic
1203443269 Un_GL000219v1:31180-31202 AAACACCCACAGGTGTGGAAGGG - Intergenic
1203456852 Un_GL000219v1:176141-176163 AAAAACCCACAGGTGTGGAGGGG + Intergenic
1203514077 Un_KI270741v1:150089-150111 AAACACCCACAGGTGTGGAAGGG - Intergenic
1203573414 Un_KI270744v1:153596-153618 AAACACCCACAGGTGTGGAGGGG + Intergenic
1185444666 X:251186-251208 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1185575883 X:1171903-1171925 AAATACCCACAGGTGTGGAGGGG + Intergenic
1185593257 X:1292301-1292323 AAATACCCACATGTGTGGAAGGG - Intronic
1185682429 X:1899492-1899514 AAATACCCACAGGGGTGGAGGGG - Intergenic
1187198786 X:17115026-17115048 AAACACCCACAGGTGTGGAGGGG - Intronic
1187403202 X:18980817-18980839 AAATACCCACAGGTGTGGAGGGG + Intronic
1187858504 X:23659898-23659920 AAACACCCACAGGTGTGGAGGGG - Intergenic
1188138991 X:26525480-26525502 AAATACTCACAGGTGTGGAGGGG - Intergenic
1189663384 X:43327274-43327296 AAATACCATCAGGTGGGGCAGGG + Intergenic
1190051862 X:47156606-47156628 CAAGATCCAGAGGGGTGGCATGG - Intronic
1190227231 X:48555536-48555558 AAATACCCACAAGTGTGGAGGGG - Intronic
1191018413 X:55835226-55835248 AAATACCCACAGGTGTGGAGGGG - Intergenic
1191033248 X:55997785-55997807 AAACACCCACAGGTGTGGAGGGG - Intergenic
1191955488 X:66638962-66638984 GAACACCCCCTGGTGTGGCAAGG - Intronic
1192626514 X:72734119-72734141 AAATGCCCACAGGTGTGGAGGGG + Intergenic
1192680310 X:73247052-73247074 CAATTCCCACATGTTTGGGAGGG + Intergenic
1193170434 X:78329588-78329610 AAATACCCACAGGCGTGGAGGGG + Intergenic
1193509778 X:82384553-82384575 CCAGAACCACAGCTGTGGCAGGG + Intergenic
1194200845 X:90951546-90951568 AAACACCCACAGGTGTGGAGGGG + Intergenic
1194219289 X:91171259-91171281 AAATACCCACAGGTGTGGAGGGG + Intergenic
1195175725 X:102313606-102313628 CAATACCCACAGGTTGACCAGGG - Intronic
1195183139 X:102373487-102373509 CAATACCCACAGGTTGACCAGGG + Intronic
1195773423 X:108376882-108376904 AAACACCCACAGGTGTGGAGGGG - Intronic
1197340870 X:125265389-125265411 GAATTCCCACATGTGTGGGAGGG + Intergenic
1197509607 X:127354907-127354929 AAATACCCACAGGTGTGGAGGGG + Intergenic
1198073993 X:133177416-133177438 CAACATCAACAGGTGTGCCAGGG - Intergenic
1198297604 X:135302754-135302776 AAACACCCACAGGTGTGGAGGGG - Intronic
1198602181 X:138295796-138295818 AAACACCCACAGGTGTGGAGGGG - Intergenic
1198974708 X:142323130-142323152 AAACACCCACAGGTGTGGAGGGG - Intergenic
1199256139 X:145720856-145720878 AAACACCCACAGGTGTGGAGGGG - Intergenic
1199612019 X:149626532-149626554 AAATACCCACAGGTGTGGAGGGG - Intronic
1199896264 X:152130546-152130568 AAACACCCACAGGTGTGGAGGGG + Intergenic
1200084065 X:153594345-153594367 GAAAACCCACAGGGGTGGGACGG + Intronic
1200257211 X:154589613-154589635 AAATACCCACAGGTGTGGATGGG + Intergenic
1200259869 X:154608436-154608458 AAATACCCACAGGTGTGGAGGGG - Intergenic
1200260559 X:154614789-154614811 AAATACCCACAGGTGTGGATGGG - Intergenic
1200487138 Y:3783349-3783371 AAACACCCACAGGTGTGGAGGGG + Intergenic
1200555802 Y:4635016-4635038 AAATACCCACAGGTGTGCAGGGG + Intergenic
1200731728 Y:6749818-6749840 AAACACCCACAGGTGTGGAGGGG + Intergenic
1200777285 Y:7180786-7180808 AAACACCCACAGGTGTGGAGGGG + Intergenic
1201356624 Y:13103838-13103860 AAACACCCACAGGTGTGGAGGGG - Intergenic
1201604860 Y:15773182-15773204 AAATGCCCACAGGTGTGGAGGGG - Intergenic
1201889191 Y:18922837-18922859 AAATATCCAAAGGGGTGGCAGGG - Intergenic
1201962670 Y:19699496-19699518 AAACACCCACAGGTGTGGAGGGG - Intergenic
1202342057 Y:23880381-23880403 AAACACCCACAGGTGTGGAGGGG - Intergenic
1202528712 Y:25789704-25789726 AAACACCCACAGGTGTGGAGGGG + Intergenic