ID: 993704946

View in Genome Browser
Species Human (GRCh38)
Location 5:91159106-91159128
Sequence TGCCATTGCTCTAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993704942_993704946 15 Left 993704942 5:91159068-91159090 CCTTTACTGAGTGCAATAGAGAG 0: 1
1: 0
2: 1
3: 11
4: 100
Right 993704946 5:91159106-91159128 TGCCATTGCTCTAAGGGGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993704946 Original CRISPR TGCCATTGCTCTAAGGGGCA AGG Intronic
900075573 1:814127-814149 TGCCATGACTCTAAGTGCCAAGG + Intergenic
902432959 1:16377821-16377843 TGCCATTGCTCTGAGTGTGAAGG + Intronic
904349075 1:29893344-29893366 GGCCATTGCTCTGAGGGGCAGGG + Intergenic
904694304 1:32319643-32319665 TGCCAGTGCTTTGAAGGGCAAGG + Intronic
905877038 1:41438446-41438468 TGTCCTTGCTCTATGGGTCAGGG - Intergenic
906611713 1:47208497-47208519 TCCCAGTGCTCTGAGGGGCGTGG - Intergenic
906685461 1:47760446-47760468 TGCCTTTGCTGTGAGGGCCAAGG - Intergenic
907050222 1:51325311-51325333 TCCCATTGCTCTTAGGGTAAAGG + Intronic
908002147 1:59690763-59690785 TGCCACTGCTTTAAGTGGCTGGG - Intronic
909057932 1:70845001-70845023 AGCCATTGCTAAAAGGGGCCAGG + Intergenic
909116088 1:71538679-71538701 TTCCAGTGCTCTAAGAGGCTTGG - Intronic
909358504 1:74735004-74735026 TGCCATTGCTCTGAAGGTGATGG - Intronic
911277502 1:95879681-95879703 AGCCATGGCTATAAGGGCCAAGG - Intergenic
911288782 1:96029241-96029263 TGCCAGTGCTCTTGGGGGCTGGG - Intergenic
912384692 1:109265424-109265446 TGCCTTTGCTCTCACAGGCAGGG + Intronic
914757537 1:150572484-150572506 TGCCATTGCACTCCGGGGCCTGG - Intergenic
916218782 1:162422264-162422286 TGGCATTGCTCTGAGGGGTAGGG - Intergenic
920819463 1:209366827-209366849 TTCCCTTTCTCTAAGAGGCAGGG - Intergenic
922271415 1:224039001-224039023 TGCCATGACTCTAAGTGCCAAGG + Intergenic
923684332 1:236143225-236143247 TGCCATTCCCAAAAGGGGCAAGG + Intronic
1063474267 10:6314924-6314946 TGCCACAGCTCAAAGGGGCATGG + Intergenic
1063522287 10:6751822-6751844 TGCCAGGGCTCAAAGGAGCAGGG + Intergenic
1064480264 10:15733679-15733701 AGCCATTCCTCTAAGGGACCTGG - Intergenic
1064585567 10:16836673-16836695 TGCCATTGCTCTGAGGATCTAGG + Intronic
1065137427 10:22685811-22685833 TGCCATTGCTGTGAGGGGCATGG - Intronic
1069944463 10:71976314-71976336 TGCCATTGCTCTCAGTGGGCAGG + Intronic
1070566200 10:77605505-77605527 TGTCAGTGCTCAAAGGGGCCTGG + Intronic
1070640996 10:78169806-78169828 TGCCATGGACCCAAGGGGCAAGG - Intergenic
1072495710 10:95957095-95957117 TGCCATGGGGCTGAGGGGCAGGG - Intronic
1074281484 10:112055804-112055826 TGGCACAGCTCTAAGGGGCAGGG + Intergenic
1074456920 10:113603389-113603411 TGCCTGTGCTGTGAGGGGCATGG + Intronic
1076195572 10:128515213-128515235 TGCCTTTGGTCCCAGGGGCATGG + Intergenic
1076565026 10:131392832-131392854 AGACATTGCTCTCAGGGGAATGG + Intergenic
1077403952 11:2374451-2374473 TCCCATTGCACTTAGGGGCAGGG - Intergenic
1079022684 11:16922850-16922872 TCCCCTTGCTCTCAGGGGAAAGG - Intronic
1079560321 11:21812649-21812671 TGACATTGCTCTAGAGAGCAAGG + Intergenic
1083303498 11:61751127-61751149 TGCCATTGCTCAAACATGCAAGG - Intergenic
1084551135 11:69842894-69842916 TGCAAGTGCCCTCAGGGGCACGG - Intergenic
1085092027 11:73725164-73725186 TTCCATTTCTCTAAGAAGCAAGG + Intronic
1085205461 11:74729451-74729473 TCACACAGCTCTAAGGGGCACGG + Intronic
1089659093 11:119974320-119974342 TGCCACAGCTCTGAGGGGCTTGG - Intergenic
1093934920 12:24990416-24990438 GGCCTTTGCTCTAAGGGAGATGG - Intergenic
1097639542 12:62163328-62163350 TTCCATTGCTCTTAGGAGCTGGG + Intronic
1102942519 12:116956212-116956234 TGCCTTTGCTGGAAGGAGCAGGG + Intronic
1103573383 12:121859258-121859280 TTCCATAGCTCTGAGAGGCACGG + Intronic
1104572590 12:129938179-129938201 TGCCATTCCCCTAAGATGCAGGG - Intergenic
1104775383 12:131387546-131387568 TCCCACTGCTCTAAGAGGCCGGG + Intergenic
1113948558 13:114058586-114058608 TGGCATTGCTCTGAGAGGGAAGG - Intronic
1119552315 14:75523959-75523981 TGCTCTTCCTCTAAGGGGGATGG - Intronic
1120735578 14:88048298-88048320 TCCCATTGCTCTAAGTGGTGTGG - Intergenic
1122128417 14:99591518-99591540 TGCCCTTCCTCTGAGGTGCAGGG - Intronic
1125722852 15:41853438-41853460 TGCCCATGCTCTGTGGGGCAGGG + Exonic
1129599426 15:76989648-76989670 TGCCACTGGTCCAAGGGGTAGGG - Intergenic
1131363821 15:91820129-91820151 TTCCATTGCTCTTAGGAGGAAGG - Intergenic
1139328191 16:66167840-66167862 GGCAATTGCACTAAGCGGCATGG + Intergenic
1139740917 16:69034237-69034259 TGCCATTGTTCCTGGGGGCAGGG - Intronic
1140137332 16:72218841-72218863 TGCAATTGTTCTATGGGGTATGG + Intergenic
1140784373 16:78326153-78326175 TGCCATTGTGCTGAGGAGCAAGG + Intronic
1140852766 16:78950383-78950405 TGCCATTGTTCTGAGAGGAAGGG + Intronic
1141680291 16:85539859-85539881 GGGCATTGCTCTAGGGGTCATGG + Intergenic
1147928677 17:43962264-43962286 TGGCATTGCATTAAGGGTCATGG - Intronic
1148454016 17:47801248-47801270 TGCCATTGGTCAAAGGGGAGGGG - Intergenic
1148746325 17:49920273-49920295 TGACATTGCTCTTTGGAGCAGGG + Intergenic
1152312198 17:79558242-79558264 CGCCTTTGCTCTGAGGGGCCTGG + Intergenic
1153992320 18:10411403-10411425 TTCCATTGCTAAAATGGGCAGGG + Intergenic
1156202466 18:34849879-34849901 TGCAAATGCTGAAAGGGGCAGGG - Intronic
1156404439 18:36770844-36770866 TGCCACTAATCCAAGGGGCAGGG - Intronic
1157479428 18:48044079-48044101 TGCCCTTGGTCTGAGGGGCCAGG + Intronic
1160257888 18:77262869-77262891 TCCCATTGCTCTTAGAGCCATGG - Intronic
1161856328 19:6767788-6767810 TTCTATTGCCCTAAGGGGCGGGG - Intergenic
1161895942 19:7080411-7080433 AGCCACTGCTCAATGGGGCAAGG - Intronic
1167063390 19:47165882-47165904 TGACAATGCTCTAAAGGGAAAGG - Intronic
1168559958 19:57374250-57374272 AGCCATGGCTAAAAGGGGCAAGG - Intronic
927731660 2:25478723-25478745 TGCCATAGGTCTAACGGGCATGG + Intronic
927995889 2:27485712-27485734 TGCAAATGCACTAAGAGGCAGGG + Intronic
929116146 2:38445991-38446013 TCCCATGGCTCTAGGGGCCAAGG - Intergenic
929687718 2:44048683-44048705 AGCTATTGCTCTATGGGACATGG - Intergenic
930939441 2:56997134-56997156 TGCCATTGCTCAAGGGGGAAAGG - Intergenic
931607347 2:64065601-64065623 TGCCATGGCTCTCAGTGGCAAGG - Intergenic
931665852 2:64609234-64609256 TGCCGGTGCTCTTGGGGGCAGGG + Intergenic
932286745 2:70540330-70540352 TTCCATTGATCTAAGGATCATGG - Intronic
934492454 2:94770947-94770969 TGCCACTGCTCTCATGGGCTGGG - Intergenic
936255813 2:110909840-110909862 TGCCAGTGTTCCAAGGTGCAAGG + Intronic
936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG + Intergenic
944349087 2:198705752-198705774 TGAAATTGCTTTAAGAGGCATGG + Intergenic
946419442 2:219556714-219556736 AGCAGTGGCTCTAAGGGGCACGG + Exonic
947864342 2:233385611-233385633 TGACTCTGCTCTAGGGGGCAAGG + Intronic
948596437 2:239082460-239082482 TGCCATGGCGCTAAGGGCGAGGG - Intronic
949082150 2:242110674-242110696 TGCCATGACTCTAAGTGCCAAGG - Intergenic
1168868480 20:1108916-1108938 TGCCATTGTCCTAAGCAGCAGGG - Intergenic
1170788856 20:19491444-19491466 GGTCATTGTGCTAAGGGGCATGG - Intronic
1171970470 20:31561905-31561927 TGCCACTGCTCTAGGCAGCATGG + Intronic
1172028097 20:31963045-31963067 TGTCACAGCTCCAAGGGGCATGG + Intergenic
1176142209 20:63549766-63549788 TCCCGTGGCTCTAAGGGGCAGGG - Intronic
1176221709 20:63972383-63972405 TGCCTTTCCTCAAAGGGGCCTGG + Intronic
1177896291 21:26858733-26858755 TTCCCTTGATATAAGGGGCATGG - Intergenic
1180106146 21:45619301-45619323 TGCCATTGCTCTAAGCCACTAGG - Intergenic
1182771764 22:32801613-32801635 TGCCATTGGTCTGAGGGGGCGGG + Intronic
1182851828 22:33481751-33481773 GGCAGTTGCTCTAACGGGCAAGG - Intronic
952947365 3:38487356-38487378 TTCCATTGCCCTAAGAGGCTAGG + Exonic
953213177 3:40894270-40894292 TGCCTTTGCTCTGAGGACCATGG + Intergenic
954036774 3:47854998-47855020 GGCCATGGCTCTCAGGAGCAAGG + Intronic
955918749 3:63932547-63932569 TGCCATTGCCCTTAGGGTAAAGG + Intronic
957428520 3:80071368-80071390 TGCCCTTCCTTTAAAGGGCATGG + Intergenic
958722316 3:97859316-97859338 TTCCACTGCTCAAGGGGGCAGGG + Intronic
964953458 3:162325026-162325048 TTCCATTGACATAAGGGGCATGG - Intergenic
969148488 4:5145065-5145087 TGCCCTTGCTGTCAAGGGCAGGG + Intronic
973265183 4:48203503-48203525 TTCCTTTGCTCTCATGGGCAGGG - Intronic
977044326 4:92050602-92050624 TGCCATAGCCCTCAGTGGCAAGG - Intergenic
978963511 4:114713098-114713120 TGCCATTCTTCAAATGGGCATGG + Intergenic
982141002 4:152317997-152318019 TCCAATTGCTATAAGGGACAAGG + Intergenic
983618701 4:169736480-169736502 TGGCACTCCTCTAAGTGGCAGGG + Intronic
985270413 4:188189329-188189351 TGCCATGACTCTGAGGGACAAGG - Intergenic
993704946 5:91159106-91159128 TGCCATTGCTCTAAGGGGCAAGG + Intronic
998204515 5:140149295-140149317 TGCCATTCTTCTGAGGGACAGGG - Intergenic
1007970905 6:46051215-46051237 TACCATTGCCCCAAGGGCCAGGG - Intronic
1010611014 6:77953808-77953830 AGCCATGGCTATAAGGGGCCAGG + Intergenic
1012450609 6:99349681-99349703 TGTCATTGCTCCCCGGGGCAGGG + Intronic
1013543578 6:111134728-111134750 TTCCCTTGATATAAGGGGCATGG - Intronic
1015406528 6:132843512-132843534 TGACATTGATCTATGGGGCTGGG + Intergenic
1016565502 6:145448387-145448409 AACCATTGCTTTAAAGGGCAGGG + Intergenic
1017139574 6:151178556-151178578 TGCCAAGGCTCTAACAGGCAGGG - Intergenic
1019024881 6:168951083-168951105 TACCATTGCTATAAGGGGACAGG + Intergenic
1033149933 7:138905381-138905403 AGCCAGGGCTCTGAGGGGCACGG - Intronic
1035082391 7:156227828-156227850 TGCCATTGGTCAAAGGGTCCTGG - Intergenic
1035242105 7:157538786-157538808 TGCCAGTGCACGGAGGGGCACGG + Intergenic
1035540065 8:427385-427407 TGCCATGACTCTAAGTGCCAAGG - Intronic
1037411656 8:18604790-18604812 AGCCATGGCTCAAAGGGGCCTGG + Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041931627 8:63293619-63293641 TGCCATTTCTCTTAGGGAGAAGG + Intergenic
1042528793 8:69794103-69794125 TGCTATTGCTTTAGAGGGCATGG + Intronic
1045317359 8:101054703-101054725 TCCCATGGCTCAAAAGGGCATGG - Intergenic
1045524005 8:102928112-102928134 TGACGTTGCTCTAAGTGCCAGGG - Intronic
1050425810 9:5511540-5511562 TACTATGGCTCTGAGGGGCAGGG + Intronic
1050888050 9:10790391-10790413 TACCAGTGCTCTCAGGGGCCTGG + Intergenic
1051237078 9:15012726-15012748 TGGCACTGCTCTAAGTGGCAGGG - Intergenic
1056327162 9:85489518-85489540 TGCCTTTGATCTTAGTGGCATGG - Intergenic
1056803905 9:89713239-89713261 TGACATTGCTCTCAGGGACCAGG + Intergenic
1061499820 9:130995407-130995429 TGTCCTTGCTCAGAGGGGCAGGG + Intergenic
1062028237 9:134350362-134350384 TTCCTTTTCTGTAAGGGGCATGG + Intronic
1186174000 X:6906121-6906143 TGCCATGGCTCTGGGGGGCAAGG + Intergenic
1186461390 X:9751158-9751180 TGCCACTACGCTAAGGGGCCAGG + Intronic
1190691563 X:52917124-52917146 TGCCAGTGCACTAGGGCGCATGG + Intergenic
1190694420 X:52938668-52938690 TGCCAGTGCACTAGGGCGCATGG - Intronic
1192200914 X:69066241-69066263 CGCCATAGCTCTAAGTAGCAGGG - Intergenic
1195885252 X:109630673-109630695 TGCCATTGCTTTACGGGGGTTGG - Intronic
1196995743 X:121381606-121381628 AGCCATTGATCTCAGGGGTAGGG + Intergenic
1197064277 X:122220469-122220491 TGCCATTGCACTTAGGGGTCAGG + Intergenic
1198367642 X:135958204-135958226 AGCCATTTCTCCAAGGAGCATGG - Intergenic
1199238023 X:145512410-145512432 TGTTATTGCTTTCAGGGGCAGGG - Intergenic