ID: 993706153

View in Genome Browser
Species Human (GRCh38)
Location 5:91172937-91172959
Sequence TCTTAAGGCAGAAACGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993706153_993706157 13 Left 993706153 5:91172937-91172959 CCAGCCACGTTTCTGCCTTAAGA No data
Right 993706157 5:91172973-91172995 ATTGGCATTTTCTGCCTTGTAGG No data
993706153_993706156 -5 Left 993706153 5:91172937-91172959 CCAGCCACGTTTCTGCCTTAAGA No data
Right 993706156 5:91172955-91172977 TAAGAGAGATTATGAGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993706153 Original CRISPR TCTTAAGGCAGAAACGTGGC TGG (reversed) Intergenic
No off target data available for this crispr