ID: 993710529

View in Genome Browser
Species Human (GRCh38)
Location 5:91220303-91220325
Sequence ATGGAGAAAGAGAATTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993710526_993710529 13 Left 993710526 5:91220267-91220289 CCTCTGGTGGGTAATATAAAGGA No data
Right 993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG No data
993710524_993710529 14 Left 993710524 5:91220266-91220288 CCCTCTGGTGGGTAATATAAAGG No data
Right 993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993710529 Original CRISPR ATGGAGAAAGAGAATTAGAA AGG Intergenic
No off target data available for this crispr