ID: 993713022

View in Genome Browser
Species Human (GRCh38)
Location 5:91246818-91246840
Sequence GCCTCATATAAATTTGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993713018_993713022 -6 Left 993713018 5:91246801-91246823 CCATGAACGGCCTCTTGGCCTCA No data
Right 993713022 5:91246818-91246840 GCCTCATATAAATTTGACTGGGG No data
993713017_993713022 -3 Left 993713017 5:91246798-91246820 CCACCATGAACGGCCTCTTGGCC No data
Right 993713022 5:91246818-91246840 GCCTCATATAAATTTGACTGGGG No data
993713014_993713022 24 Left 993713014 5:91246771-91246793 CCAAAGTGCTGAGATTACAGGCA 0: 6164
1: 104376
2: 239808
3: 242871
4: 213140
Right 993713022 5:91246818-91246840 GCCTCATATAAATTTGACTGGGG No data
993713013_993713022 25 Left 993713013 5:91246770-91246792 CCCAAAGTGCTGAGATTACAGGC 0: 12157
1: 235981
2: 273803
3: 180251
4: 143342
Right 993713022 5:91246818-91246840 GCCTCATATAAATTTGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993713022 Original CRISPR GCCTCATATAAATTTGACTG GGG Intergenic
No off target data available for this crispr