ID: 993715813

View in Genome Browser
Species Human (GRCh38)
Location 5:91274831-91274853
Sequence CTACCTTGAAGCTGCCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993715812_993715813 7 Left 993715812 5:91274801-91274823 CCAGAAAAAAAATAAAATAAAAT No data
Right 993715813 5:91274831-91274853 CTACCTTGAAGCTGCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993715813 Original CRISPR CTACCTTGAAGCTGCCCCTC TGG Intergenic
No off target data available for this crispr