ID: 993721858

View in Genome Browser
Species Human (GRCh38)
Location 5:91329262-91329284
Sequence ATGAAATTCCAACACTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993721858_993721860 5 Left 993721858 5:91329262-91329284 CCTCTTCAGTGTTGGAATTTCAT No data
Right 993721860 5:91329290-91329312 TTCCATTGTATCTTTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993721858 Original CRISPR ATGAAATTCCAACACTGAAG AGG (reversed) Intergenic
No off target data available for this crispr