ID: 993724767

View in Genome Browser
Species Human (GRCh38)
Location 5:91354877-91354899
Sequence AACAAGTGGTCTTAGTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993724767_993724774 24 Left 993724767 5:91354877-91354899 CCAGTACACTAAGACCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 57
Right 993724774 5:91354924-91354946 CCAAGAAGAAATAAGTCTGTAGG No data
993724767_993724770 -5 Left 993724767 5:91354877-91354899 CCAGTACACTAAGACCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 57
Right 993724770 5:91354895-91354917 TTGTTACCGTGGCTGTACTGTGG 0: 1
1: 0
2: 0
3: 3
4: 123
993724767_993724771 -4 Left 993724767 5:91354877-91354899 CCAGTACACTAAGACCACTTGTT 0: 1
1: 0
2: 0
3: 7
4: 57
Right 993724771 5:91354896-91354918 TGTTACCGTGGCTGTACTGTGGG 0: 1
1: 0
2: 1
3: 2
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993724767 Original CRISPR AACAAGTGGTCTTAGTGTAC TGG (reversed) Intergenic
906248212 1:44291941-44291963 ACCAAGTTATCTTAGTGTAGTGG - Intronic
911664995 1:100541822-100541844 AACAAGTGGTCCTAATGTCCTGG - Exonic
921519194 1:216138560-216138582 AAAAAGAGGACTTGGTGTACTGG - Intronic
1071728743 10:88226442-88226464 ATCAAGTGTTCTTTGTGTTCTGG - Intergenic
1073832289 10:107399063-107399085 ATCAAAGGGGCTTAGTGTACAGG + Intergenic
1077438015 11:2553623-2553645 ACCAAGTGGGCTTTGTGTAAGGG - Intronic
1081498017 11:43635393-43635415 AATAAGTGGTATTATTGCACGGG - Intronic
1090560005 11:127921781-127921803 AACAAGTAGACTTAGTGTCGAGG + Intergenic
1090653100 11:128824121-128824143 ACCAAGTGGTCTTTGTGGAAAGG + Intergenic
1092032397 12:5298208-5298230 ATCAATTGGTCTCAGTGTTCTGG + Intergenic
1094529834 12:31263860-31263882 AGCAAAAGTTCTTAGTGTACGGG - Intergenic
1095649491 12:44590269-44590291 AACAGGTGTTCTTAGTTGACAGG - Intronic
1102665368 12:114567745-114567767 AAAAAGTGGTCTTGGTGCAAGGG - Intergenic
1112289467 13:98132446-98132468 AAAAAGATGTCTTAGTATACTGG - Intergenic
1115531388 14:34331377-34331399 TAAAAGTGGGCATAGTGTACTGG - Intronic
1118202412 14:63688653-63688675 AAAAAGTGGTTTCAGTGTAGTGG - Intronic
1119139105 14:72249170-72249192 AAAAAGTTGTCTTAGTCTTCAGG + Intronic
1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG + Intergenic
1123827683 15:24100353-24100375 AATAACTGGTCTTTGTGTGCTGG - Intergenic
1123842142 15:24259765-24259787 AATAACTGGTCTTTGTGTGCTGG - Intergenic
1123857165 15:24425823-24425845 AATAACTGGTCTTTGTGTGCTGG - Intergenic
1123861796 15:24476350-24476372 AATAACTGGTCTTTGTGTGCTGG - Intergenic
1126836667 15:52674196-52674218 AAAATGTGGTCTTAGTGTAGAGG - Intronic
1127353487 15:58175350-58175372 AACAAGTGGTCTAAGTGTGGAGG + Intronic
1128686378 15:69689174-69689196 AGCAAGTGGTCCTAATGAACTGG + Intergenic
1134270281 16:12726881-12726903 AAAAAATGGTGTTAGTGTACGGG + Intronic
1137578218 16:49617819-49617841 AACAAGTGGCCATTGTGTCCTGG - Intronic
1141873836 16:86807748-86807770 AACCAGTGGTTTTAGATTACTGG - Intergenic
1146787999 17:35735005-35735027 AAGAGGTGGGCTTAGTGCACTGG - Intronic
1158631101 18:59114730-59114752 AAAAAGTGTTTTTAGTGCACAGG + Intergenic
938557003 2:132434364-132434386 AAAAAGTGTTCTTATTGTCCAGG - Intronic
939856815 2:147368322-147368344 AATAGGTGGTCTTAGAGTTCAGG - Intergenic
942388388 2:175465832-175465854 ATCAAGTGTTCTTTGTGTATTGG + Intergenic
943266780 2:185741434-185741456 TAAAAGTGTTCTTAGTTTACAGG + Intronic
1170167904 20:13380987-13381009 AACCAGTGGTCTTAGCTTGCTGG + Intergenic
1176756305 21:10728188-10728210 ATCAAATGGACTTAGTGAACTGG - Intergenic
1183834433 22:40440631-40440653 AGCAAGTGCTCTTGGTGCACTGG + Intronic
951949926 3:28188656-28188678 AAAAAGTGTTCTTATTGTCCAGG - Intergenic
952626050 3:35404777-35404799 AACAAATGTTCTTATTGTCCTGG + Intergenic
955728991 3:61963944-61963966 AACATGTGGTTTCAGTGTACAGG + Intronic
958938903 3:100288354-100288376 AACAAGTGGTATTTTTGTAGGGG - Intronic
967651866 3:191995480-191995502 AACAGGTGGTGTTTGTTTACAGG - Intergenic
970909981 4:21263611-21263633 TACAAGTTGTCTTAGAGCACCGG - Intronic
971862894 4:32131087-32131109 AAAAAGTGTTCTTATTGTCCAGG + Intergenic
977779332 4:100961991-100962013 AACAAGTTGTTTTAGTCTATTGG - Intergenic
978420308 4:108525748-108525770 AAAAAGTGTTCTTATTGTCCAGG - Intergenic
978438106 4:108707512-108707534 AGCAAGTGGGCTAAGTGCACAGG + Intergenic
987210285 5:15674822-15674844 AAGAAGTTGTCTTAGTGAACTGG + Intronic
990273819 5:54174368-54174390 AAAGAGTGGTTTTGGTGTACAGG + Intronic
992432281 5:76720759-76720781 AATATGTGGTCTTAGTGTCTGGG + Intronic
993724767 5:91354877-91354899 AACAAGTGGTCTTAGTGTACTGG - Intergenic
996135189 5:119832668-119832690 AAAAAGTGGTCATAGTTGACCGG - Intergenic
1008786760 6:55177107-55177129 AACAAGTAGCCTTACTGTAGAGG - Intronic
1009463448 6:63941862-63941884 AACAAGTGTTCTCATTGTCCAGG - Intronic
1013671717 6:112410587-112410609 AAAAATAGGTCTTAGTCTACTGG + Intergenic
1015400154 6:132779652-132779674 AAGAAGGGGTCTTAGGTTACAGG + Intronic
1018435101 6:163752242-163752264 ATCAAGTAGTCTGAGTGTGCAGG - Intergenic
1020850492 7:13346965-13346987 TATAGGTGGTCTTAGTGTATTGG + Intergenic
1022848858 7:34239379-34239401 AACAAGTGGTGTAAGTGGCCAGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1051783295 9:20713955-20713977 AACAAGTTGTTTTAGTGTTGTGG + Intronic
1052106134 9:24518999-24519021 AAATAGTGGTGTTAGTGGACTGG + Intergenic
1059055179 9:110971862-110971884 AACAAGTGATTTTAGTGAACTGG - Intronic
1061512283 9:131068540-131068562 GACAAGTGTTCTTAGGGAACAGG + Intronic
1200619407 Y:5422706-5422728 AACAAGTGGTCTTAGAAATCTGG + Intronic