ID: 993731639

View in Genome Browser
Species Human (GRCh38)
Location 5:91429698-91429720
Sequence CAGCCTCTCCAGAGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993731639_993731643 19 Left 993731639 5:91429698-91429720 CCTTTTGTCCTCTGGAGAGGCTG No data
Right 993731643 5:91429740-91429762 TTTTCAAACCTAGCATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993731639 Original CRISPR CAGCCTCTCCAGAGGACAAA AGG (reversed) Intergenic
No off target data available for this crispr