ID: 993744504

View in Genome Browser
Species Human (GRCh38)
Location 5:91580233-91580255
Sequence TGGGTGCTATTGACATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993744500_993744504 -4 Left 993744500 5:91580214-91580236 CCGATGTGGTATTTTTCACTGGG No data
Right 993744504 5:91580233-91580255 TGGGTGCTATTGACATTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993744504 Original CRISPR TGGGTGCTATTGACATTGGG TGG Intergenic
No off target data available for this crispr