ID: 993744703

View in Genome Browser
Species Human (GRCh38)
Location 5:91582966-91582988
Sequence CAGAATGAAGTGCCTTTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993744693_993744703 11 Left 993744693 5:91582932-91582954 CCCAGTGTGTTAAGTTGATCCCC No data
Right 993744703 5:91582966-91582988 CAGAATGAAGTGCCTTTAGGGGG No data
993744696_993744703 -9 Left 993744696 5:91582952-91582974 CCCAGTATAAAACCCAGAATGAA No data
Right 993744703 5:91582966-91582988 CAGAATGAAGTGCCTTTAGGGGG No data
993744697_993744703 -10 Left 993744697 5:91582953-91582975 CCAGTATAAAACCCAGAATGAAG No data
Right 993744703 5:91582966-91582988 CAGAATGAAGTGCCTTTAGGGGG No data
993744694_993744703 10 Left 993744694 5:91582933-91582955 CCAGTGTGTTAAGTTGATCCCCA No data
Right 993744703 5:91582966-91582988 CAGAATGAAGTGCCTTTAGGGGG No data
993744692_993744703 27 Left 993744692 5:91582916-91582938 CCAGCAACACTTTTTACCCAGTG No data
Right 993744703 5:91582966-91582988 CAGAATGAAGTGCCTTTAGGGGG No data
993744695_993744703 -8 Left 993744695 5:91582951-91582973 CCCCAGTATAAAACCCAGAATGA No data
Right 993744703 5:91582966-91582988 CAGAATGAAGTGCCTTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993744703 Original CRISPR CAGAATGAAGTGCCTTTAGG GGG Intergenic
No off target data available for this crispr