ID: 993748181

View in Genome Browser
Species Human (GRCh38)
Location 5:91628696-91628718
Sequence GTCCTAGGATTCAGGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993748178_993748181 12 Left 993748178 5:91628661-91628683 CCTTCATAAATGGGTAACATAAT No data
Right 993748181 5:91628696-91628718 GTCCTAGGATTCAGGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993748181 Original CRISPR GTCCTAGGATTCAGGAAAAG AGG Intergenic
No off target data available for this crispr