ID: 993748476

View in Genome Browser
Species Human (GRCh38)
Location 5:91633025-91633047
Sequence CTGTGTCAACAGAAGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993748474_993748476 17 Left 993748474 5:91632985-91633007 CCTATTAAAAGTGTGATCAGGTA No data
Right 993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG No data
993748472_993748476 28 Left 993748472 5:91632974-91632996 CCAGTCAGCTGCCTATTAAAAGT No data
Right 993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993748476 Original CRISPR CTGTGTCAACAGAAGGAAAG TGG Intergenic
No off target data available for this crispr