ID: 993774856

View in Genome Browser
Species Human (GRCh38)
Location 5:91980671-91980693
Sequence TAGTTGATCTGGCAGCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993774856_993774862 29 Left 993774856 5:91980671-91980693 CCCTAATGCTGCCAGATCAACTA No data
Right 993774862 5:91980723-91980745 CCTTACAACCTTCACTTTGAAGG No data
993774856_993774859 2 Left 993774856 5:91980671-91980693 CCCTAATGCTGCCAGATCAACTA No data
Right 993774859 5:91980696-91980718 GTGTAATGAACAACGTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993774856 Original CRISPR TAGTTGATCTGGCAGCATTA GGG (reversed) Intergenic
No off target data available for this crispr