ID: 993775257

View in Genome Browser
Species Human (GRCh38)
Location 5:91986784-91986806
Sequence CTCAAACAAACCTGCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993775257_993775262 22 Left 993775257 5:91986784-91986806 CCCTCTCTGCAGGTTTGTTTGAG No data
Right 993775262 5:91986829-91986851 AAGTTACAGCTCATGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993775257 Original CRISPR CTCAAACAAACCTGCAGAGA GGG (reversed) Intergenic
No off target data available for this crispr