ID: 993777249

View in Genome Browser
Species Human (GRCh38)
Location 5:92014613-92014635
Sequence ATCCAAAAGCTATTGCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993777249_993777254 27 Left 993777249 5:92014613-92014635 CCAATCAGCAATAGCTTTTGGAT No data
Right 993777254 5:92014663-92014685 TTCACCACTTTGCAATACTTGGG No data
993777249_993777253 26 Left 993777249 5:92014613-92014635 CCAATCAGCAATAGCTTTTGGAT No data
Right 993777253 5:92014662-92014684 CTTCACCACTTTGCAATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993777249 Original CRISPR ATCCAAAAGCTATTGCTGAT TGG (reversed) Intergenic
No off target data available for this crispr