ID: 993780694

View in Genome Browser
Species Human (GRCh38)
Location 5:92062403-92062425
Sequence GACAGCTCTTGACTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993780691_993780694 15 Left 993780691 5:92062365-92062387 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 993780694 5:92062403-92062425 GACAGCTCTTGACTTGTTACTGG No data
993780692_993780694 11 Left 993780692 5:92062369-92062391 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 993780694 5:92062403-92062425 GACAGCTCTTGACTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993780694 Original CRISPR GACAGCTCTTGACTTGTTAC TGG Intergenic
No off target data available for this crispr