ID: 993792625

View in Genome Browser
Species Human (GRCh38)
Location 5:92225203-92225225
Sequence CAAAATACTGATAGTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993792625_993792628 4 Left 993792625 5:92225203-92225225 CCCATCTCACTATCAGTATTTTG No data
Right 993792628 5:92225230-92225252 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993792625 Original CRISPR CAAAATACTGATAGTGAGAT GGG (reversed) Intergenic
No off target data available for this crispr