ID: 993794859

View in Genome Browser
Species Human (GRCh38)
Location 5:92254512-92254534
Sequence TGGTATGAGACGGCAGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993794859_993794862 20 Left 993794859 5:92254512-92254534 CCACAAGCTGCCGTCTCATACCA No data
Right 993794862 5:92254555-92254577 AAAGTCAAAAAATAACATGTTGG 0: 17
1: 109
2: 144
3: 260
4: 1180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993794859 Original CRISPR TGGTATGAGACGGCAGCTTG TGG (reversed) Intergenic
No off target data available for this crispr