ID: 993795055

View in Genome Browser
Species Human (GRCh38)
Location 5:92256710-92256732
Sequence TTTGGTTTTGCCACAACGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993795053_993795055 -1 Left 993795053 5:92256688-92256710 CCTAAGAAATTAGCAGACAGAAT No data
Right 993795055 5:92256710-92256732 TTTGGTTTTGCCACAACGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993795055 Original CRISPR TTTGGTTTTGCCACAACGAC TGG Intergenic
No off target data available for this crispr