ID: 993802692

View in Genome Browser
Species Human (GRCh38)
Location 5:92363294-92363316
Sequence AGCTTCCCCTAAAAGAACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993802691_993802692 -9 Left 993802691 5:92363280-92363302 CCTTTCATGTTGGCAGCTTCCCC No data
Right 993802692 5:92363294-92363316 AGCTTCCCCTAAAAGAACGATGG No data
993802689_993802692 15 Left 993802689 5:92363256-92363278 CCTTAATCTTTTATCAGAGAAAT No data
Right 993802692 5:92363294-92363316 AGCTTCCCCTAAAAGAACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993802692 Original CRISPR AGCTTCCCCTAAAAGAACGA TGG Intergenic
No off target data available for this crispr