ID: 993806172

View in Genome Browser
Species Human (GRCh38)
Location 5:92412639-92412661
Sequence CTCTATCTTCATAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993806172_993806174 -8 Left 993806172 5:92412639-92412661 CCATCCACTTTATGAAGATAGAG No data
Right 993806174 5:92412654-92412676 AGATAGAGTAATATTTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993806172 Original CRISPR CTCTATCTTCATAAAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr