ID: 993809290

View in Genome Browser
Species Human (GRCh38)
Location 5:92455942-92455964
Sequence CACTCTTGAAACAGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993809285_993809290 29 Left 993809285 5:92455890-92455912 CCTGTTTTTAAGGTTGTTGTCTT No data
Right 993809290 5:92455942-92455964 CACTCTTGAAACAGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993809290 Original CRISPR CACTCTTGAAACAGTCCTGG TGG Intergenic
No off target data available for this crispr