ID: 993809341

View in Genome Browser
Species Human (GRCh38)
Location 5:92456503-92456525
Sequence AGCTATATGTTCAACTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993809341_993809348 24 Left 993809341 5:92456503-92456525 CCCTCTTAGTTGAACATATAGCT No data
Right 993809348 5:92456550-92456572 TGTATGTATTTATTTATTGAAGG No data
993809341_993809349 25 Left 993809341 5:92456503-92456525 CCCTCTTAGTTGAACATATAGCT No data
Right 993809349 5:92456551-92456573 GTATGTATTTATTTATTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993809341 Original CRISPR AGCTATATGTTCAACTAAGA GGG (reversed) Intergenic
No off target data available for this crispr