ID: 993812069

View in Genome Browser
Species Human (GRCh38)
Location 5:92492835-92492857
Sequence TGCTATGTCAATAATCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993812064_993812069 19 Left 993812064 5:92492793-92492815 CCCTCACTGTTGTTTGTCAGGGT No data
Right 993812069 5:92492835-92492857 TGCTATGTCAATAATCTGCCTGG No data
993812065_993812069 18 Left 993812065 5:92492794-92492816 CCTCACTGTTGTTTGTCAGGGTG No data
Right 993812069 5:92492835-92492857 TGCTATGTCAATAATCTGCCTGG No data
993812062_993812069 20 Left 993812062 5:92492792-92492814 CCCCTCACTGTTGTTTGTCAGGG No data
Right 993812069 5:92492835-92492857 TGCTATGTCAATAATCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993812069 Original CRISPR TGCTATGTCAATAATCTGCC TGG Intergenic
No off target data available for this crispr