ID: 993812751

View in Genome Browser
Species Human (GRCh38)
Location 5:92503160-92503182
Sequence AAGAATAAAGAGAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993812751_993812753 6 Left 993812751 5:92503160-92503182 CCTTGCTCCTTCTCTTTATTCTT No data
Right 993812753 5:92503189-92503211 CATATTGTAACCCAGATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993812751 Original CRISPR AAGAATAAAGAGAAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr