ID: 993812753

View in Genome Browser
Species Human (GRCh38)
Location 5:92503189-92503211
Sequence CATATTGTAACCCAGATCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993812750_993812753 19 Left 993812750 5:92503147-92503169 CCATCTGCTGACACCTTGCTCCT No data
Right 993812753 5:92503189-92503211 CATATTGTAACCCAGATCATTGG No data
993812749_993812753 30 Left 993812749 5:92503136-92503158 CCTTGTTGCTGCCATCTGCTGAC No data
Right 993812753 5:92503189-92503211 CATATTGTAACCCAGATCATTGG No data
993812752_993812753 -1 Left 993812752 5:92503167-92503189 CCTTCTCTTTATTCTTTTTTAAC No data
Right 993812753 5:92503189-92503211 CATATTGTAACCCAGATCATTGG No data
993812751_993812753 6 Left 993812751 5:92503160-92503182 CCTTGCTCCTTCTCTTTATTCTT No data
Right 993812753 5:92503189-92503211 CATATTGTAACCCAGATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993812753 Original CRISPR CATATTGTAACCCAGATCAT TGG Intergenic
No off target data available for this crispr