ID: 993814318

View in Genome Browser
Species Human (GRCh38)
Location 5:92522486-92522508
Sequence AGGCCATTTTATTAAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993814318_993814326 1 Left 993814318 5:92522486-92522508 CCCTCTTTTTAATAAAATGGCCT No data
Right 993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993814318 Original CRISPR AGGCCATTTTATTAAAAAGA GGG (reversed) Intergenic
No off target data available for this crispr