ID: 993814326

View in Genome Browser
Species Human (GRCh38)
Location 5:92522510-92522532
Sequence CCTGGGGACCAGAGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993814319_993814326 0 Left 993814319 5:92522487-92522509 CCTCTTTTTAATAAAATGGCCTC No data
Right 993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG No data
993814318_993814326 1 Left 993814318 5:92522486-92522508 CCCTCTTTTTAATAAAATGGCCT No data
Right 993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993814326 Original CRISPR CCTGGGGACCAGAGAGTAGA AGG Intergenic
No off target data available for this crispr