ID: 993818070

View in Genome Browser
Species Human (GRCh38)
Location 5:92577942-92577964
Sequence TTGCATGTATAGATGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993818070_993818073 18 Left 993818070 5:92577942-92577964 CCCAGAGCCATCTATACATGCAA No data
Right 993818073 5:92577983-92578005 GCAGTTTTGCCATGTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993818070 Original CRISPR TTGCATGTATAGATGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr