ID: 993818371

View in Genome Browser
Species Human (GRCh38)
Location 5:92581776-92581798
Sequence TTCTGGTTAGCTATCCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993818371_993818376 18 Left 993818371 5:92581776-92581798 CCTAGGAGGATAGCTAACCAGAA No data
Right 993818376 5:92581817-92581839 ATAAGAAGCCTATATCAACAGGG No data
993818371_993818375 17 Left 993818371 5:92581776-92581798 CCTAGGAGGATAGCTAACCAGAA No data
Right 993818375 5:92581816-92581838 TATAAGAAGCCTATATCAACAGG No data
993818371_993818374 -6 Left 993818371 5:92581776-92581798 CCTAGGAGGATAGCTAACCAGAA No data
Right 993818374 5:92581793-92581815 CCAGAATGTGGAGAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993818371 Original CRISPR TTCTGGTTAGCTATCCTCCT AGG (reversed) Intergenic
No off target data available for this crispr