ID: 993830802

View in Genome Browser
Species Human (GRCh38)
Location 5:92755681-92755703
Sequence GAGCCTAGACTACTATAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993830799_993830802 23 Left 993830799 5:92755635-92755657 CCTGTCTATGCAGGGCAGGTCGT No data
Right 993830802 5:92755681-92755703 GAGCCTAGACTACTATAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993830802 Original CRISPR GAGCCTAGACTACTATAGAT TGG Intergenic
No off target data available for this crispr