ID: 993831763

View in Genome Browser
Species Human (GRCh38)
Location 5:92768973-92768995
Sequence CTAATGGAAAGGAGCTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993831763_993831769 21 Left 993831763 5:92768973-92768995 CCACCTAAGCTCCTTTCCATTAG No data
Right 993831769 5:92769017-92769039 AAATAATAGCTAGATACATTGGG No data
993831763_993831770 24 Left 993831763 5:92768973-92768995 CCACCTAAGCTCCTTTCCATTAG No data
Right 993831770 5:92769020-92769042 TAATAGCTAGATACATTGGGAGG No data
993831763_993831768 20 Left 993831763 5:92768973-92768995 CCACCTAAGCTCCTTTCCATTAG No data
Right 993831768 5:92769016-92769038 GAAATAATAGCTAGATACATTGG No data
993831763_993831771 28 Left 993831763 5:92768973-92768995 CCACCTAAGCTCCTTTCCATTAG No data
Right 993831771 5:92769024-92769046 AGCTAGATACATTGGGAGGCAGG No data
993831763_993831772 29 Left 993831763 5:92768973-92768995 CCACCTAAGCTCCTTTCCATTAG No data
Right 993831772 5:92769025-92769047 GCTAGATACATTGGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993831763 Original CRISPR CTAATGGAAAGGAGCTTAGG TGG (reversed) Intergenic
No off target data available for this crispr