ID: 993832799

View in Genome Browser
Species Human (GRCh38)
Location 5:92780257-92780279
Sequence AGTGCGGTAGACCCCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993832797_993832799 2 Left 993832797 5:92780232-92780254 CCACTGACAGACAAAGTAGTGAG No data
Right 993832799 5:92780257-92780279 AGTGCGGTAGACCCCACTTCAGG No data
993832796_993832799 11 Left 993832796 5:92780223-92780245 CCTGCAGCACCACTGACAGACAA No data
Right 993832799 5:92780257-92780279 AGTGCGGTAGACCCCACTTCAGG No data
993832795_993832799 12 Left 993832795 5:92780222-92780244 CCCTGCAGCACCACTGACAGACA No data
Right 993832799 5:92780257-92780279 AGTGCGGTAGACCCCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993832799 Original CRISPR AGTGCGGTAGACCCCACTTC AGG Intergenic
No off target data available for this crispr