ID: 993837722

View in Genome Browser
Species Human (GRCh38)
Location 5:92835451-92835473
Sequence CTGTGGATCAGGAGATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993837722_993837726 -6 Left 993837722 5:92835451-92835473 CCAGGGGATCTCCTGATCCACAG No data
Right 993837726 5:92835468-92835490 CCACAGGTTGCACAGATCTGTGG 0: 7
1: 15
2: 28
3: 120
4: 456
993837722_993837729 17 Left 993837722 5:92835451-92835473 CCAGGGGATCTCCTGATCCACAG No data
Right 993837729 5:92835491-92835513 CAAAAGCATGGTTTCCCAGGTGG No data
993837722_993837730 18 Left 993837722 5:92835451-92835473 CCAGGGGATCTCCTGATCCACAG No data
Right 993837730 5:92835492-92835514 AAAAGCATGGTTTCCCAGGTGGG No data
993837722_993837727 5 Left 993837722 5:92835451-92835473 CCAGGGGATCTCCTGATCCACAG No data
Right 993837727 5:92835479-92835501 ACAGATCTGTGGCAAAAGCATGG No data
993837722_993837728 14 Left 993837722 5:92835451-92835473 CCAGGGGATCTCCTGATCCACAG No data
Right 993837728 5:92835488-92835510 TGGCAAAAGCATGGTTTCCCAGG No data
993837722_993837731 19 Left 993837722 5:92835451-92835473 CCAGGGGATCTCCTGATCCACAG No data
Right 993837731 5:92835493-92835515 AAAGCATGGTTTCCCAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993837722 Original CRISPR CTGTGGATCAGGAGATCCCC TGG (reversed) Intergenic
No off target data available for this crispr