ID: 993838935

View in Genome Browser
Species Human (GRCh38)
Location 5:92852135-92852157
Sequence CTATGTAAAAGTAATAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993838934_993838935 18 Left 993838934 5:92852094-92852116 CCAATAAAAACATATTGATTCAT No data
Right 993838935 5:92852135-92852157 CTATGTAAAAGTAATAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993838935 Original CRISPR CTATGTAAAAGTAATAAAGT AGG Intergenic
No off target data available for this crispr