ID: 993846509

View in Genome Browser
Species Human (GRCh38)
Location 5:92951113-92951135
Sequence GAAAATTAACAAGGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993846509_993846512 9 Left 993846509 5:92951113-92951135 CCAGTGTTTCCTTGTTAATTTTC No data
Right 993846512 5:92951145-92951167 GGTCTGTCTAATGTTGAGAGTGG No data
993846509_993846513 10 Left 993846509 5:92951113-92951135 CCAGTGTTTCCTTGTTAATTTTC No data
Right 993846513 5:92951146-92951168 GTCTGTCTAATGTTGAGAGTGGG No data
993846509_993846514 11 Left 993846509 5:92951113-92951135 CCAGTGTTTCCTTGTTAATTTTC No data
Right 993846514 5:92951147-92951169 TCTGTCTAATGTTGAGAGTGGGG 0: 40
1: 5520
2: 3202
3: 2325
4: 2114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993846509 Original CRISPR GAAAATTAACAAGGAAACAC TGG (reversed) Intergenic
No off target data available for this crispr