ID: 993858567

View in Genome Browser
Species Human (GRCh38)
Location 5:93105458-93105480
Sequence ACAAATACCTAATGAATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4855
Summary {0: 11, 1: 548, 2: 1095, 3: 1541, 4: 1660}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858567_993858574 14 Left 993858567 5:93105458-93105480 CCCCACATTCATTAGGTATTTGT 0: 11
1: 548
2: 1095
3: 1541
4: 1660
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858567_993858576 18 Left 993858567 5:93105458-93105480 CCCCACATTCATTAGGTATTTGT 0: 11
1: 548
2: 1095
3: 1541
4: 1660
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993858567 Original CRISPR ACAAATACCTAATGAATGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr