ID: 993858568

View in Genome Browser
Species Human (GRCh38)
Location 5:93105459-93105481
Sequence GACAAATACCTAATGAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5855
Summary {0: 11, 1: 581, 2: 1592, 3: 1687, 4: 1984}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858568_993858574 13 Left 993858568 5:93105459-93105481 CCCACATTCATTAGGTATTTGTC 0: 11
1: 581
2: 1592
3: 1687
4: 1984
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858568_993858576 17 Left 993858568 5:93105459-93105481 CCCACATTCATTAGGTATTTGTC 0: 11
1: 581
2: 1592
3: 1687
4: 1984
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993858568 Original CRISPR GACAAATACCTAATGAATGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr