ID: 993858569

View in Genome Browser
Species Human (GRCh38)
Location 5:93105460-93105482
Sequence GGACAAATACCTAATGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4025
Summary {0: 13, 1: 953, 2: 1153, 3: 1033, 4: 873}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858569_993858574 12 Left 993858569 5:93105460-93105482 CCACATTCATTAGGTATTTGTCC 0: 13
1: 953
2: 1153
3: 1033
4: 873
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858569_993858576 16 Left 993858569 5:93105460-93105482 CCACATTCATTAGGTATTTGTCC 0: 13
1: 953
2: 1153
3: 1033
4: 873
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993858569 Original CRISPR GGACAAATACCTAATGAATG TGG (reversed) Intergenic
Too many off-targets to display for this crispr