ID: 993858570

View in Genome Browser
Species Human (GRCh38)
Location 5:93105481-93105503
Sequence ACTTGGAAAAGATGTATAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858570_993858576 -5 Left 993858570 5:93105481-93105503 CCCCCTATACATCTTTTCCAAGT No data
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data
993858570_993858574 -9 Left 993858570 5:93105481-93105503 CCCCCTATACATCTTTTCCAAGT No data
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993858570 Original CRISPR ACTTGGAAAAGATGTATAGG GGG (reversed) Intergenic
No off target data available for this crispr