ID: 993858571

View in Genome Browser
Species Human (GRCh38)
Location 5:93105482-93105504
Sequence AACTTGGAAAAGATGTATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858571_993858574 -10 Left 993858571 5:93105482-93105504 CCCCTATACATCTTTTCCAAGTT No data
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858571_993858576 -6 Left 993858571 5:93105482-93105504 CCCCTATACATCTTTTCCAAGTT No data
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993858571 Original CRISPR AACTTGGAAAAGATGTATAG GGG (reversed) Intergenic
No off target data available for this crispr