ID: 993858574

View in Genome Browser
Species Human (GRCh38)
Location 5:93105495-93105517
Sequence TTTCCAAGTTTGTCTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858567_993858574 14 Left 993858567 5:93105458-93105480 CCCCACATTCATTAGGTATTTGT 0: 11
1: 548
2: 1095
3: 1541
4: 1660
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858568_993858574 13 Left 993858568 5:93105459-93105481 CCCACATTCATTAGGTATTTGTC 0: 11
1: 581
2: 1592
3: 1687
4: 1984
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858569_993858574 12 Left 993858569 5:93105460-93105482 CCACATTCATTAGGTATTTGTCC 0: 13
1: 953
2: 1153
3: 1033
4: 873
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858570_993858574 -9 Left 993858570 5:93105481-93105503 CCCCCTATACATCTTTTCCAAGT No data
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data
993858571_993858574 -10 Left 993858571 5:93105482-93105504 CCCCTATACATCTTTTCCAAGTT No data
Right 993858574 5:93105495-93105517 TTTCCAAGTTTGTCTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993858574 Original CRISPR TTTCCAAGTTTGTCTGACTC AGG Intergenic
No off target data available for this crispr