ID: 993858576

View in Genome Browser
Species Human (GRCh38)
Location 5:93105499-93105521
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858571_993858576 -6 Left 993858571 5:93105482-93105504 CCCCTATACATCTTTTCCAAGTT No data
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data
993858569_993858576 16 Left 993858569 5:93105460-93105482 CCACATTCATTAGGTATTTGTCC 0: 13
1: 953
2: 1153
3: 1033
4: 873
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data
993858572_993858576 -7 Left 993858572 5:93105483-93105505 CCCTATACATCTTTTCCAAGTTT No data
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data
993858573_993858576 -8 Left 993858573 5:93105484-93105506 CCTATACATCTTTTCCAAGTTTG No data
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data
993858570_993858576 -5 Left 993858570 5:93105481-93105503 CCCCCTATACATCTTTTCCAAGT No data
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data
993858568_993858576 17 Left 993858568 5:93105459-93105481 CCCACATTCATTAGGTATTTGTC 0: 11
1: 581
2: 1592
3: 1687
4: 1984
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data
993858567_993858576 18 Left 993858567 5:93105458-93105480 CCCCACATTCATTAGGTATTTGT 0: 11
1: 548
2: 1095
3: 1541
4: 1660
Right 993858576 5:93105499-93105521 CAAGTTTGTCTGACTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr