ID: 993858589

View in Genome Browser
Species Human (GRCh38)
Location 5:93105630-93105652
Sequence ATGAAGTATCAGAATGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993858589_993858597 13 Left 993858589 5:93105630-93105652 CCCCCTTCATTCTGATACTTCAT No data
Right 993858597 5:93105666-93105688 CCACTTAAAGAGTCCTTTAAGGG No data
993858589_993858598 14 Left 993858589 5:93105630-93105652 CCCCCTTCATTCTGATACTTCAT No data
Right 993858598 5:93105667-93105689 CACTTAAAGAGTCCTTTAAGGGG No data
993858589_993858595 12 Left 993858589 5:93105630-93105652 CCCCCTTCATTCTGATACTTCAT No data
Right 993858595 5:93105665-93105687 TCCACTTAAAGAGTCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993858589 Original CRISPR ATGAAGTATCAGAATGAAGG GGG (reversed) Intergenic
No off target data available for this crispr