ID: 993861804

View in Genome Browser
Species Human (GRCh38)
Location 5:93145399-93145421
Sequence CTGTGTCAGTGGGATGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993861804_993861809 7 Left 993861804 5:93145399-93145421 CCTTGTACATCCCACTGACACAG No data
Right 993861809 5:93145429-93145451 ACCCCCTTCCAGCTGTGCTCAGG No data
993861804_993861815 28 Left 993861804 5:93145399-93145421 CCTTGTACATCCCACTGACACAG No data
Right 993861815 5:93145450-93145472 GGCACAAAGAAACCCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993861804 Original CRISPR CTGTGTCAGTGGGATGTACA AGG (reversed) Intergenic
No off target data available for this crispr