ID: 993864513

View in Genome Browser
Species Human (GRCh38)
Location 5:93176257-93176279
Sequence CAGAGTAGACAGAAGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993864513_993864518 8 Left 993864513 5:93176257-93176279 CCCCAACCCTTCTGTCTACTCTG No data
Right 993864518 5:93176288-93176310 TTCAAATGCAAATCAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993864513 Original CRISPR CAGAGTAGACAGAAGGGTTG GGG (reversed) Intergenic
No off target data available for this crispr