ID: 993877119

View in Genome Browser
Species Human (GRCh38)
Location 5:93320680-93320702
Sequence TTGTACATGATTAAAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993877119_993877122 22 Left 993877119 5:93320680-93320702 CCATCCTTTTTAATCATGTACAA No data
Right 993877122 5:93320725-93320747 TTAATTCCAAACAGAAAAGTGGG No data
993877119_993877121 21 Left 993877119 5:93320680-93320702 CCATCCTTTTTAATCATGTACAA No data
Right 993877121 5:93320724-93320746 CTTAATTCCAAACAGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993877119 Original CRISPR TTGTACATGATTAAAAAGGA TGG (reversed) Intergenic
No off target data available for this crispr