ID: 993878812

View in Genome Browser
Species Human (GRCh38)
Location 5:93339858-93339880
Sequence ATCATGAATCATCATACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
993878812_993878815 4 Left 993878812 5:93339858-93339880 CCTGGTGTATGATGATTCATGAT No data
Right 993878815 5:93339885-93339907 GACAAAAATCAGACTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
993878812 Original CRISPR ATCATGAATCATCATACACC AGG (reversed) Intergenic
No off target data available for this crispr